ID: 1030671578

View in Genome Browser
Species Human (GRCh38)
Location 7:112344032-112344054
Sequence AAACTATTTCAGATTAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030671576_1030671578 23 Left 1030671576 7:112343986-112344008 CCTTTACTATTCAAAAATTTTAA No data
Right 1030671578 7:112344032-112344054 AAACTATTTCAGATTAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030671578 Original CRISPR AAACTATTTCAGATTAAAGG TGG Intergenic
No off target data available for this crispr