ID: 1030672702 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:112354474-112354496 |
| Sequence | ATCCTGTTATTGTGGCAACA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1030672702_1030672704 | -6 | Left | 1030672702 | 7:112354474-112354496 | CCATGTTGCCACAATAACAGGAT | No data | ||
| Right | 1030672704 | 7:112354491-112354513 | CAGGATTTCATTCTTTTTTATGG | 0: 205 1: 1560 2: 4545 3: 10269 4: 18841 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1030672702 | Original CRISPR | ATCCTGTTATTGTGGCAACA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||