ID: 1030672702

View in Genome Browser
Species Human (GRCh38)
Location 7:112354474-112354496
Sequence ATCCTGTTATTGTGGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030672702_1030672704 -6 Left 1030672702 7:112354474-112354496 CCATGTTGCCACAATAACAGGAT No data
Right 1030672704 7:112354491-112354513 CAGGATTTCATTCTTTTTTATGG 0: 205
1: 1560
2: 4545
3: 10269
4: 18841

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030672702 Original CRISPR ATCCTGTTATTGTGGCAACA TGG (reversed) Intergenic
No off target data available for this crispr