ID: 1030673487

View in Genome Browser
Species Human (GRCh38)
Location 7:112362455-112362477
Sequence CAGGGAATGAAAGCTGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030673487_1030673491 0 Left 1030673487 7:112362455-112362477 CCTTCATCAGCTTTCATTCCCTG No data
Right 1030673491 7:112362478-112362500 AACCAAACTGCCACTTCACTGGG No data
1030673487_1030673490 -1 Left 1030673487 7:112362455-112362477 CCTTCATCAGCTTTCATTCCCTG No data
Right 1030673490 7:112362477-112362499 GAACCAAACTGCCACTTCACTGG No data
1030673487_1030673494 7 Left 1030673487 7:112362455-112362477 CCTTCATCAGCTTTCATTCCCTG No data
Right 1030673494 7:112362485-112362507 CTGCCACTTCACTGGGGCTGAGG No data
1030673487_1030673492 1 Left 1030673487 7:112362455-112362477 CCTTCATCAGCTTTCATTCCCTG No data
Right 1030673492 7:112362479-112362501 ACCAAACTGCCACTTCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030673487 Original CRISPR CAGGGAATGAAAGCTGATGA AGG (reversed) Intergenic
No off target data available for this crispr