ID: 1030676410

View in Genome Browser
Species Human (GRCh38)
Location 7:112390379-112390401
Sequence CCTCATCTGTAAAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2830
Summary {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030676403_1030676410 13 Left 1030676403 7:112390343-112390365 CCTTGGGCAAGGTGTAACCTCTC No data
Right 1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
1030676404_1030676410 -4 Left 1030676404 7:112390360-112390382 CCTCTCTGTGCCTCAGTCTCCTC 0: 16
1: 376
2: 1718
3: 4597
4: 9223
Right 1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030676410 Original CRISPR CCTCATCTGTAAAATGGGGA TGG Intergenic
Too many off-targets to display for this crispr