ID: 1030676944

View in Genome Browser
Species Human (GRCh38)
Location 7:112394161-112394183
Sequence CAGCAGCCTTGGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030676944_1030676950 -9 Left 1030676944 7:112394161-112394183 CCCAGCTCCATCCAAGGCTGCTG No data
Right 1030676950 7:112394175-112394197 AGGCTGCTGATAGGACTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030676944 Original CRISPR CAGCAGCCTTGGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr