ID: 1030677592

View in Genome Browser
Species Human (GRCh38)
Location 7:112400268-112400290
Sequence CTGGAAATTGATGTGTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030677592_1030677595 12 Left 1030677592 7:112400268-112400290 CCTGGCTACACATCAATTTCCAG No data
Right 1030677595 7:112400303-112400325 TACGTACTGCTTCTTTTTCTAGG No data
1030677592_1030677596 15 Left 1030677592 7:112400268-112400290 CCTGGCTACACATCAATTTCCAG No data
Right 1030677596 7:112400306-112400328 GTACTGCTTCTTTTTCTAGGAGG No data
1030677592_1030677597 30 Left 1030677592 7:112400268-112400290 CCTGGCTACACATCAATTTCCAG No data
Right 1030677597 7:112400321-112400343 CTAGGAGGCGTATGATGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030677592 Original CRISPR CTGGAAATTGATGTGTAGCC AGG (reversed) Intergenic
No off target data available for this crispr