ID: 1030683884

View in Genome Browser
Species Human (GRCh38)
Location 7:112463087-112463109
Sequence CCTTCCAATGGTAAGATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030683884 Original CRISPR CCTTCCAATGGTAAGATTTG AGG (reversed) Intronic
901766364 1:11502411-11502433 CCTTCCTATGGCCAGATTTCTGG - Intronic
904057139 1:27678734-27678756 CCTTCCAAAGGTAAAATCTTTGG + Intergenic
909525797 1:76621039-76621061 GCTCCCAATGGTATGATTTATGG - Intronic
911105434 1:94127212-94127234 ACTTAAAATTGTAAGATTTGGGG + Intergenic
911194171 1:94976935-94976957 CCTTGCAGTTGTAGGATTTGTGG - Exonic
913157843 1:116117543-116117565 CCCTCCAAAGGTAAGAGTTGAGG - Intronic
913382789 1:118229115-118229137 CCTTCCAATGCTCAGACTTCAGG - Intergenic
916459319 1:165006784-165006806 CCTTCTAATTCTAAAATTTGTGG - Intergenic
924596964 1:245454798-245454820 CCTTTCTATTGTAAGAATTGTGG + Intronic
1066174047 10:32885514-32885536 CCTTCCATTGATAAGATTTAAGG + Intergenic
1067410710 10:46061850-46061872 CCTTCCAATGTTGAGATTACAGG + Intergenic
1068191509 10:53658424-53658446 CCTTCCAATGTTAGAATTGGAGG + Intergenic
1077776964 11:5282564-5282586 GCTTGCATTGGTAAAATTTGGGG + Intronic
1077838179 11:5943477-5943499 ACTTGGAAAGGTAAGATTTGGGG + Intergenic
1083999795 11:66289780-66289802 CCTGCGTATGGGAAGATTTGGGG + Intergenic
1084939053 11:72602550-72602572 CCTTCCGATGGTGACCTTTGTGG - Intronic
1088098305 11:106125436-106125458 CCTTGCAATAATACGATTTGGGG + Intergenic
1088611893 11:111585360-111585382 ATTTCCAAAGATAAGATTTGGGG + Intergenic
1088734751 11:112719487-112719509 CCTTCCAAAGGGAATATTTTAGG - Intergenic
1089619728 11:119715208-119715230 CCTTCCAATGCTAAGACTCCAGG + Intronic
1090014476 11:123073866-123073888 CCTTCCGATGGTATTATCTGAGG - Intronic
1090766656 11:129882073-129882095 CCTTCCTATGGTAAGCGTTTTGG - Exonic
1092749333 12:11703813-11703835 CCTTTCAATTTTAAGATTTGAGG + Intronic
1095179019 12:39125688-39125710 CATTCCAATGGTTTGATTTGTGG + Intergenic
1098134010 12:67382311-67382333 TCTTCCAGTGGAGAGATTTGGGG + Intergenic
1100188859 12:92168558-92168580 CTTTCCCATGGTAACACTTGTGG - Intergenic
1101988453 12:109465574-109465596 CCTTCCAAAGGTAAGCATTTGGG - Intronic
1102803570 12:115759172-115759194 CCTGCCAATGCAAAGACTTGGGG + Intergenic
1108100517 13:46949135-46949157 CCTTTAAATGGTGAGTTTTGGGG + Intergenic
1108848794 13:54703807-54703829 CCTTCCAATGCCCAGATTTCAGG - Intergenic
1109210406 13:59528618-59528640 GCATCTATTGGTAAGATTTGAGG + Intergenic
1109424597 13:62153457-62153479 CCTTCCAATGCCAAGACTTCAGG - Intergenic
1115459908 14:33649005-33649027 CCTCCCAATGGTAAGTTCTTGGG - Intronic
1117167705 14:53055509-53055531 CCTCCCAATGTTCATATTTGAGG - Intronic
1117573113 14:57068948-57068970 CCTCCTAATGGGAAAATTTGGGG + Intergenic
1118564234 14:67121885-67121907 TCTTCCATTGGGAATATTTGAGG - Intronic
1121417093 14:93787348-93787370 CCTTCCAATGATAACATTCTAGG - Intronic
1121692498 14:95887958-95887980 CATTCCAATGGTGAGATTGTAGG - Intergenic
1126551574 15:49936657-49936679 TCTTTCAATTGGAAGATTTGGGG + Intronic
1126788618 15:52199782-52199804 CCTTCCAATTGGAGGATCTGTGG + Intronic
1132597027 16:757183-757205 CCTCCCAATGCTAGGATTTCAGG - Intronic
1133419811 16:5636681-5636703 CCTTCCAAGGGTATGATCTCAGG - Intergenic
1134351237 16:13439894-13439916 CCTTCTAATGGAAAGTTTGGAGG - Intergenic
1135913520 16:26582556-26582578 TCTTCCAACCATAAGATTTGGGG + Intergenic
1140692424 16:77497223-77497245 CCTCCCATTTCTAAGATTTGTGG + Intergenic
1144003667 17:11079376-11079398 CCCTCCAATGCCAAAATTTGGGG + Intergenic
1146221751 17:31029594-31029616 CCTTCTAATGGTAAAATTGATGG + Intergenic
1146795230 17:35775661-35775683 TTTTCCCATGGTAAGATGTGAGG + Intronic
1147419879 17:40317215-40317237 CCTTCCAGTGGGAAGTTCTGTGG + Intronic
1150631966 17:66886121-66886143 CCTTACAAGGGTAATATTTCCGG + Intergenic
1151290080 17:73143440-73143462 CCTTGCAAGGGTAATGTTTGAGG + Intergenic
1154321177 18:13354380-13354402 CTTTGAAATGGTAAGATTTTGGG + Intronic
1156056584 18:33012510-33012532 TCTTCCAATGCCAAGATTTGGGG - Intronic
1156718716 18:40043950-40043972 GCTTCCATTGGTAAGATTTAAGG + Intergenic
1156996532 18:43475118-43475140 ACTTCCAATTCTAAGATTTACGG + Intergenic
1158675430 18:59513724-59513746 CCTGGCAATGGTAACATTAGAGG + Intronic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1162284402 19:9727419-9727441 CCTTTCAATGGGAAGATCTGGGG - Intergenic
1164753672 19:30674008-30674030 CCTTCAGATGGTCAGATTTATGG + Intronic
925013950 2:507768-507790 CCTTCTAATGGTGAGATTCCAGG - Intergenic
927807621 2:26161930-26161952 CCTTTCAATGGCAGGATTTAGGG - Intergenic
928007685 2:27578363-27578385 CCTTCAAATCGTAAAATCTGAGG + Exonic
929117146 2:38453953-38453975 CCTTTCTATAGTAAGATTTTAGG + Intergenic
930169612 2:48237571-48237593 CCTTCCAATGGGAGAAGTTGTGG + Intergenic
933220164 2:79678974-79678996 CCCTCCACTGTTCAGATTTGTGG + Intronic
934920701 2:98342952-98342974 CGTTCCAATGGTAGGACTTCAGG + Intronic
935076966 2:99754835-99754857 CCTGCCAATGGTAAGTTTTCAGG - Intronic
936150855 2:110021524-110021546 CCTTCAGATGGTGTGATTTGAGG - Intergenic
936193821 2:110349845-110349867 CCTTCAGATGGTGTGATTTGAGG + Intergenic
939064787 2:137469951-137469973 GTTTCAAATGGTTAGATTTGGGG + Intronic
940689253 2:156894708-156894730 TCTTCCAATGGCAGGATTCGAGG + Intergenic
942812438 2:180014676-180014698 CCTTCCGATGTTCAGACTTGTGG - Intergenic
943034276 2:182722042-182722064 CTTTCCAATGTTATGATTTCAGG - Exonic
943055208 2:182968848-182968870 CCTTGCCATGGTAGGGTTTGAGG - Intronic
946826454 2:223683705-223683727 TCTTTGAATGATAAGATTTGGGG + Intergenic
947180803 2:227409715-227409737 TCTTCCATTTTTAAGATTTGAGG - Intergenic
1172145058 20:32751695-32751717 CCTTCAAATGGCAGGATTTCTGG + Intergenic
1172178274 20:32985669-32985691 CCTTCCAATGGTGATATTCCAGG - Intronic
1173235861 20:41244865-41244887 CCTTCCAAGGGTGAGAGGTGAGG - Intronic
1173600530 20:44291915-44291937 CATTCCAATGGTAAGAATGGAGG + Intergenic
1177278585 21:18948914-18948936 CCTTCCAATGATCTGTTTTGTGG + Intergenic
1179928174 21:44550051-44550073 CCTTCCCATGGCAAGGGTTGGGG - Intronic
1179939509 21:44628663-44628685 CCTTCCCATGGCAAGGGTTGGGG + Intronic
1181507047 22:23366265-23366287 GCTGCCTATGGTAAGAATTGTGG - Intergenic
1184450718 22:44580949-44580971 CCTTCCACTGGCAGGATTGGGGG + Intergenic
949832197 3:8226764-8226786 TCTTCCAATAGTAACATTTTGGG + Intergenic
951731992 3:25820054-25820076 TGTTGAAATGGTAAGATTTGGGG + Intergenic
955046392 3:55364485-55364507 CCATCCAATGGTGAAATTTTTGG - Intergenic
958603776 3:96332149-96332171 CCTGCCACTGGTAACATATGTGG + Intergenic
959060191 3:101609581-101609603 CCTTCCAATGAGAAAATATGTGG + Intergenic
959899940 3:111649657-111649679 TCTTTCAATGCTAAGAATTGAGG - Intronic
961437749 3:126931204-126931226 CCTTCCCATGGAAAGAGTTGAGG + Intronic
967772417 3:193348804-193348826 CCTTGCAGCAGTAAGATTTGGGG - Intronic
971470652 4:27022551-27022573 CCTTCCAATGGAAGAATTTAAGG - Exonic
972719944 4:41686068-41686090 CTTTCCAATGTTTAAATTTGTGG - Intronic
976476392 4:85488536-85488558 TTTTCCAATGGAAAGATTGGAGG - Intronic
978318962 4:107472197-107472219 CCTTTCAATGGGAATATTAGTGG - Intergenic
978747339 4:112209010-112209032 CCTTCCAATGCCCAGATTTCAGG - Intergenic
986236772 5:5918039-5918061 CTTTCAAATGGTAACATTTAAGG - Intergenic
989819875 5:45784341-45784363 CCTTCCACTGGTAATATATTTGG - Intergenic
993866469 5:93202489-93202511 CCTTCCATTGCAAAGTTTTGAGG - Intergenic
993956947 5:94245812-94245834 CAAGCCAATGGTAAGAATTGTGG - Intronic
994819978 5:104636995-104637017 CCTTCCAATGGGAAAAGATGGGG + Intergenic
999847975 5:155506262-155506284 GGTTCCCAGGGTAAGATTTGGGG - Intergenic
1000201703 5:159017435-159017457 CCTTCTAATGGGAAGAGCTGAGG - Intronic
1001112480 5:168908844-168908866 GCTTCCCATGGTAAGACCTGAGG + Intronic
1001452602 5:171837959-171837981 CCTTCTAGTGGTAAGATGAGGGG - Intergenic
1005947724 6:30606455-30606477 CGTTCCACTGGTAAGACTGGCGG - Exonic
1010757984 6:79689709-79689731 ATTTCCAATGTTATGATTTGGGG + Intronic
1014878586 6:126693024-126693046 CCTTCACATGGTAAGTTTGGTGG + Intergenic
1016183534 6:141175277-141175299 CCTTTCAATGGTACTAGTTGTGG - Intergenic
1020832632 7:13110567-13110589 TCTATCAGTGGTAAGATTTGGGG + Intergenic
1027295995 7:76771467-76771489 CCTTACAATGGTGAGATCTCAGG - Intergenic
1027532685 7:79354741-79354763 CCTCACAATGGTAATATTAGAGG + Intronic
1027612622 7:80380467-80380489 CCTACGAATGGTAAGAGCTGGGG - Intronic
1027791269 7:82640655-82640677 CCTTCCAATGCTCAGACTTCAGG - Intergenic
1030416498 7:109250777-109250799 GATTCCAAGGATAAGATTTGGGG - Intergenic
1030683884 7:112463087-112463109 CCTTCCAATGGTAAGATTTGAGG - Intronic
1031811804 7:126378992-126379014 CCTTTGAATGGTAAGAAATGGGG + Intergenic
1031892083 7:127306479-127306501 GCTCTCAATGGTCAGATTTGAGG + Intergenic
1032067795 7:128784630-128784652 GCTTCCAATTGTAGGATATGTGG + Intergenic
1035402260 7:158574570-158574592 CCTTCCTAAGGTTAGATGTGGGG + Intronic
1037656296 8:20887064-20887086 CCTTCAAATGGTCAGCTCTGTGG + Intergenic
1039999537 8:42564585-42564607 CCTTCCAATGCCCAGATTTCAGG + Intergenic
1041268626 8:56089190-56089212 CCTTACAATGGACAGATTTACGG + Intergenic
1042414404 8:68502435-68502457 TCTTCCACTGGGAAGAGTTGAGG + Intronic
1042667464 8:71222233-71222255 CCTTCCACTGGTAACATATTTGG + Intronic
1047565363 8:126038693-126038715 CATTCCAATGAAAAGATTGGGGG - Intergenic
1051936068 9:22444488-22444510 ACTTCCAATGACCAGATTTGTGG - Intergenic
1053456217 9:38234853-38234875 CATTGCAATGGTATGATCTGTGG - Intergenic
1054779278 9:69151588-69151610 CCCTGCAATGGTAAGATTTTGGG - Intronic
1056392636 9:86153707-86153729 CCTTCCAATGCCAAGACTTCAGG + Intergenic
1058650347 9:107170090-107170112 CCTTCCAAGTGTTAGTTTTGGGG + Intergenic
1059820962 9:117971471-117971493 CCTTTCAAAGGTGAGACTTGGGG + Intergenic
1062632959 9:137474700-137474722 GCTTCTGATGGTCAGATTTGGGG - Intronic
1186869824 X:13760198-13760220 CCTTGCAATGGTGAGATAAGTGG + Exonic
1191214733 X:57922725-57922747 CCTTTCAGTGGGAAGATCTGGGG + Intergenic
1193070033 X:77297307-77297329 CCTTTCAATGGGAAGATCTGGGG + Intergenic
1193211641 X:78812954-78812976 CTGTCCAATGGTAAGAGTGGGGG - Intergenic
1197620753 X:128744874-128744896 CCTTCCTCTGGCAAGATTTGTGG - Intergenic
1199551818 X:149069218-149069240 CTTGCCATTGGTAAGGTTTGTGG + Intergenic
1199779212 X:151042774-151042796 CCTCCCAATTGTAAGAGTTGTGG - Intergenic
1199787740 X:151119946-151119968 CTTTCCACTGGAAATATTTGAGG - Intergenic
1201631388 Y:16074826-16074848 CCTTCCAATGCTCAGACTTCAGG - Intergenic
1202074574 Y:21025541-21025563 CCTTCCAATGCCCAGATTTCAGG + Intergenic