ID: 1030688711

View in Genome Browser
Species Human (GRCh38)
Location 7:112511335-112511357
Sequence AGCATGAAATGAGACAACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030688711_1030688714 29 Left 1030688711 7:112511335-112511357 CCAGCGTTGTCTCATTTCATGCT No data
Right 1030688714 7:112511387-112511409 AAGCAACCCTATTTTATAGATGG No data
1030688711_1030688712 -2 Left 1030688711 7:112511335-112511357 CCAGCGTTGTCTCATTTCATGCT No data
Right 1030688712 7:112511356-112511378 CTCATAACAATCCTATGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030688711 Original CRISPR AGCATGAAATGAGACAACGC TGG (reversed) Intergenic
No off target data available for this crispr