ID: 1030694869

View in Genome Browser
Species Human (GRCh38)
Location 7:112573897-112573919
Sequence TCAGAACCCATCCCCCACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030694869_1030694871 14 Left 1030694869 7:112573897-112573919 CCTCCGTGGGGGATGGGTTCTGA No data
Right 1030694871 7:112573934-112573956 ATCTGCCCCCTCCATCCCCTAGG No data
1030694869_1030694872 17 Left 1030694869 7:112573897-112573919 CCTCCGTGGGGGATGGGTTCTGA No data
Right 1030694872 7:112573937-112573959 TGCCCCCTCCATCCCCTAGGTGG No data
1030694869_1030694875 20 Left 1030694869 7:112573897-112573919 CCTCCGTGGGGGATGGGTTCTGA No data
Right 1030694875 7:112573940-112573962 CCCCTCCATCCCCTAGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030694869 Original CRISPR TCAGAACCCATCCCCCACGG AGG (reversed) Intergenic