ID: 1030695258

View in Genome Browser
Species Human (GRCh38)
Location 7:112578090-112578112
Sequence CTGTATCCACTGATGGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030695258_1030695265 1 Left 1030695258 7:112578090-112578112 CCTATCACCATCAGTGGATACAG No data
Right 1030695265 7:112578114-112578136 AAGGAATAATTTGGGAATTGGGG No data
1030695258_1030695261 -8 Left 1030695258 7:112578090-112578112 CCTATCACCATCAGTGGATACAG No data
Right 1030695261 7:112578105-112578127 GGATACAGAAAGGAATAATTTGG No data
1030695258_1030695262 -7 Left 1030695258 7:112578090-112578112 CCTATCACCATCAGTGGATACAG No data
Right 1030695262 7:112578106-112578128 GATACAGAAAGGAATAATTTGGG No data
1030695258_1030695263 -1 Left 1030695258 7:112578090-112578112 CCTATCACCATCAGTGGATACAG No data
Right 1030695263 7:112578112-112578134 GAAAGGAATAATTTGGGAATTGG No data
1030695258_1030695266 2 Left 1030695258 7:112578090-112578112 CCTATCACCATCAGTGGATACAG No data
Right 1030695266 7:112578115-112578137 AGGAATAATTTGGGAATTGGGGG No data
1030695258_1030695264 0 Left 1030695258 7:112578090-112578112 CCTATCACCATCAGTGGATACAG No data
Right 1030695264 7:112578113-112578135 AAAGGAATAATTTGGGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030695258 Original CRISPR CTGTATCCACTGATGGTGAT AGG (reversed) Intergenic
No off target data available for this crispr