ID: 1030695261

View in Genome Browser
Species Human (GRCh38)
Location 7:112578105-112578127
Sequence GGATACAGAAAGGAATAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030695258_1030695261 -8 Left 1030695258 7:112578090-112578112 CCTATCACCATCAGTGGATACAG No data
Right 1030695261 7:112578105-112578127 GGATACAGAAAGGAATAATTTGG No data
1030695255_1030695261 0 Left 1030695255 7:112578082-112578104 CCCTGACTCCTATCACCATCAGT No data
Right 1030695261 7:112578105-112578127 GGATACAGAAAGGAATAATTTGG No data
1030695254_1030695261 19 Left 1030695254 7:112578063-112578085 CCAGTGTATCAGTTTTTCTCCCT No data
Right 1030695261 7:112578105-112578127 GGATACAGAAAGGAATAATTTGG No data
1030695256_1030695261 -1 Left 1030695256 7:112578083-112578105 CCTGACTCCTATCACCATCAGTG No data
Right 1030695261 7:112578105-112578127 GGATACAGAAAGGAATAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030695261 Original CRISPR GGATACAGAAAGGAATAATT TGG Intergenic
No off target data available for this crispr