ID: 1030695334

View in Genome Browser
Species Human (GRCh38)
Location 7:112579055-112579077
Sequence CACACTCTAATTCCTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030695334_1030695336 3 Left 1030695334 7:112579055-112579077 CCTGCTCTAGGAATTAGAGTGTG No data
Right 1030695336 7:112579081-112579103 CAACAAGGTCCCTGCGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030695334 Original CRISPR CACACTCTAATTCCTAGAGC AGG (reversed) Intergenic
No off target data available for this crispr