ID: 1030696997

View in Genome Browser
Species Human (GRCh38)
Location 7:112596365-112596387
Sequence TTAACCACTTTTTAGTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030696996_1030696997 -1 Left 1030696996 7:112596343-112596365 CCAGGACTGGGTAATTTTCACTT No data
Right 1030696997 7:112596365-112596387 TTAACCACTTTTTAGTTGACAGG No data
1030696992_1030696997 26 Left 1030696992 7:112596316-112596338 CCAAATCTTAGGTCACATGAATG No data
Right 1030696997 7:112596365-112596387 TTAACCACTTTTTAGTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030696997 Original CRISPR TTAACCACTTTTTAGTTGAC AGG Intergenic
No off target data available for this crispr