ID: 1030698687

View in Genome Browser
Species Human (GRCh38)
Location 7:112615050-112615072
Sequence GCAGCCTTGGAAGCAGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030698687_1030698692 -3 Left 1030698687 7:112615050-112615072 CCACTACCTGCTTCCAAGGCTGC No data
Right 1030698692 7:112615070-112615092 TGCAGAATGGTGCCTGGAATTGG No data
1030698687_1030698694 13 Left 1030698687 7:112615050-112615072 CCACTACCTGCTTCCAAGGCTGC No data
Right 1030698694 7:112615086-112615108 GAATTGGCTCCTTCCTTAGCAGG No data
1030698687_1030698691 -9 Left 1030698687 7:112615050-112615072 CCACTACCTGCTTCCAAGGCTGC No data
Right 1030698691 7:112615064-112615086 CAAGGCTGCAGAATGGTGCCTGG No data
1030698687_1030698696 24 Left 1030698687 7:112615050-112615072 CCACTACCTGCTTCCAAGGCTGC No data
Right 1030698696 7:112615097-112615119 TTCCTTAGCAGGAAGTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030698687 Original CRISPR GCAGCCTTGGAAGCAGGTAG TGG (reversed) Intergenic
No off target data available for this crispr