ID: 1030701521

View in Genome Browser
Species Human (GRCh38)
Location 7:112646672-112646694
Sequence CTGGATTCCTTAGAATTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030701519_1030701521 -6 Left 1030701519 7:112646655-112646677 CCACTCATCTAGGCTGCCTGGAT No data
Right 1030701521 7:112646672-112646694 CTGGATTCCTTAGAATTAACAGG No data
1030701518_1030701521 -5 Left 1030701518 7:112646654-112646676 CCCACTCATCTAGGCTGCCTGGA No data
Right 1030701521 7:112646672-112646694 CTGGATTCCTTAGAATTAACAGG No data
1030701512_1030701521 28 Left 1030701512 7:112646621-112646643 CCTTGGTGGAGAAGGTGTGTTTC No data
Right 1030701521 7:112646672-112646694 CTGGATTCCTTAGAATTAACAGG No data
1030701511_1030701521 29 Left 1030701511 7:112646620-112646642 CCCTTGGTGGAGAAGGTGTGTTT No data
Right 1030701521 7:112646672-112646694 CTGGATTCCTTAGAATTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030701521 Original CRISPR CTGGATTCCTTAGAATTAAC AGG Intergenic
No off target data available for this crispr