ID: 1030701661

View in Genome Browser
Species Human (GRCh38)
Location 7:112647308-112647330
Sequence AAGCCCACACCCCACAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030701661_1030701666 3 Left 1030701661 7:112647308-112647330 CCTTGGCTGTGGGGTGTGGGCTT No data
Right 1030701666 7:112647334-112647356 TGCCCCATGTGGCTCTCAGGTGG 0: 32
1: 73
2: 118
3: 141
4: 268
1030701661_1030701662 -8 Left 1030701661 7:112647308-112647330 CCTTGGCTGTGGGGTGTGGGCTT No data
Right 1030701662 7:112647323-112647345 GTGGGCTTCCCTGCCCCATGTGG No data
1030701661_1030701667 4 Left 1030701661 7:112647308-112647330 CCTTGGCTGTGGGGTGTGGGCTT No data
Right 1030701667 7:112647335-112647357 GCCCCATGTGGCTCTCAGGTGGG 0: 32
1: 68
2: 129
3: 146
4: 282
1030701661_1030701664 0 Left 1030701661 7:112647308-112647330 CCTTGGCTGTGGGGTGTGGGCTT No data
Right 1030701664 7:112647331-112647353 CCCTGCCCCATGTGGCTCTCAGG 0: 23
1: 66
2: 114
3: 132
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030701661 Original CRISPR AAGCCCACACCCCACAGCCA AGG (reversed) Intergenic
No off target data available for this crispr