ID: 1030710983

View in Genome Browser
Species Human (GRCh38)
Location 7:112748710-112748732
Sequence CTGCTAAACCAGAGCTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030710980_1030710983 -3 Left 1030710980 7:112748690-112748712 CCCTTGATTTTTTCATACTACTG No data
Right 1030710983 7:112748710-112748732 CTGCTAAACCAGAGCTGACAGGG No data
1030710981_1030710983 -4 Left 1030710981 7:112748691-112748713 CCTTGATTTTTTCATACTACTGC No data
Right 1030710983 7:112748710-112748732 CTGCTAAACCAGAGCTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030710983 Original CRISPR CTGCTAAACCAGAGCTGACA GGG Intergenic
No off target data available for this crispr