ID: 1030711649

View in Genome Browser
Species Human (GRCh38)
Location 7:112757317-112757339
Sequence GTGAGTACCCCCACTGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030711644_1030711649 2 Left 1030711644 7:112757292-112757314 CCTTGGAGAGAGTTGTTATAATG No data
Right 1030711649 7:112757317-112757339 GTGAGTACCCCCACTGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030711649 Original CRISPR GTGAGTACCCCCACTGGGAG GGG Intergenic
No off target data available for this crispr