ID: 1030711712

View in Genome Browser
Species Human (GRCh38)
Location 7:112757627-112757649
Sequence TCCAGGTGGCCCTCATGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030711712_1030711718 10 Left 1030711712 7:112757627-112757649 CCTGCCCATGAGGGCCACCTGGA No data
Right 1030711718 7:112757660-112757682 GACCTCAGTACAGAGAAGCTAGG No data
1030711712_1030711719 11 Left 1030711712 7:112757627-112757649 CCTGCCCATGAGGGCCACCTGGA No data
Right 1030711719 7:112757661-112757683 ACCTCAGTACAGAGAAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030711712 Original CRISPR TCCAGGTGGCCCTCATGGGC AGG (reversed) Intergenic
No off target data available for this crispr