ID: 1030714153

View in Genome Browser
Species Human (GRCh38)
Location 7:112789351-112789373
Sequence GCCGGATTTTTGCTAGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 50}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030714153 Original CRISPR GCCGGATTTTTGCTAGTCAC TGG (reversed) Intronic
901180079 1:7335724-7335746 GCAGGAATTTTGCCAGTCAGTGG + Intronic
904927552 1:34060616-34060638 GCAGGATTTGTGCAAGTCATGGG + Intronic
910799292 1:91129699-91129721 GCCAGAATTTTGCCAGTCAGAGG + Intergenic
911246108 1:95519584-95519606 GCTGTATATTTGCCAGTCACAGG + Intergenic
916547417 1:165818761-165818783 GCAGCATTTTTCCTAGTCCCAGG - Intronic
924217829 1:241842686-241842708 TCTGGATCTTTGCTATTCACTGG + Intergenic
924613203 1:245590539-245590561 GCCTGATTTTTGGTAAACACTGG - Intronic
1063276733 10:4577208-4577230 GCTGGAATTTTGATAGACACTGG - Intergenic
1092576669 12:9791396-9791418 GCCAGATTTTTGCAAGTCTTTGG + Intergenic
1095473605 12:42563264-42563286 GCTGGAATTTTGCTTGCCACAGG - Intronic
1103144140 12:118579635-118579657 GCCCAATTTGTGCTAGGCACTGG + Intergenic
1106144663 13:27040283-27040305 GCCTGCTTTTTGTTAGTCTCTGG - Intergenic
1108223841 13:48267005-48267027 GGGGGATTTTTGATTGTCACAGG + Exonic
1116364018 14:44038450-44038472 GACTGATTTTTGCTACTCAATGG - Intergenic
1128193232 15:65724938-65724960 GCCCTTTTTTTGCTAGGCACTGG - Intronic
1134886641 16:17799052-17799074 CCTGGAATTTTGCTAGTCCCAGG + Intergenic
1135054655 16:19220839-19220861 GCAGGATTTTTGCTGGAGACAGG + Intronic
1135987780 16:27196743-27196765 GCCGAATTTTTGTTAGAGACAGG + Intergenic
1138347802 16:56330703-56330725 TCCGGCTTTTTGCTAGTTACAGG + Intronic
1139118164 16:63982348-63982370 GCCGGTTTTTGGCTAATCACAGG - Intergenic
927965632 2:27265917-27265939 GTAGGATTTTAGCTGGTCACAGG + Intronic
938172624 2:129093186-129093208 GCCGGCTTTTGACCAGTCACAGG + Intergenic
939155128 2:138515926-138515948 TACTGATTATTGCTAGTCACAGG + Intronic
940774557 2:157873370-157873392 GCTGGATATGTGCTAGGCACTGG - Intronic
944901743 2:204223022-204223044 GCCTCATTCTTCCTAGTCACAGG - Intergenic
1173052235 20:39574612-39574634 GCGGGAGTTTTGCTAATCATGGG + Intergenic
1179521457 21:41948280-41948302 GCCGGCTTTGTGCTGGGCACTGG + Intronic
952156063 3:30644831-30644853 GCAGGATTTCTGGTTGTCACAGG - Exonic
956092435 3:65682249-65682271 GGAGTATTTTTGCTAGTCAAGGG - Intronic
960949170 3:122987917-122987939 ACTGGATCTTTGCAAGTCACTGG + Intronic
964247158 3:154666941-154666963 GCCTGATTTTTCCTGGACACTGG - Intergenic
970086190 4:12348877-12348899 GCTGGATATTTGCCAGTCATAGG - Intergenic
971015162 4:22481267-22481289 TCCTGATTTTTGCTTATCACAGG - Intronic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
982412879 4:155098930-155098952 GCTGGATTTTTGCTGGTTTCTGG - Intergenic
982523423 4:156448962-156448984 GGCTGATTTTTGCTAGAGACTGG - Intergenic
987561729 5:19532310-19532332 TCCGCATTTATGCTTGTCACTGG + Intronic
991980182 5:72222150-72222172 GCCTGATTTTTATTAGTCAGAGG - Intronic
995394404 5:111672337-111672359 GCTGGGTGATTGCTAGTCACTGG - Intronic
999376744 5:151092065-151092087 GCCTGCTGTTTGCTAGGCACTGG - Intronic
999573086 5:152942902-152942924 GCCTGATGTTTGATATTCACTGG - Intergenic
1000483296 5:161806516-161806538 GTCAGATTTTTGCTAGTCACTGG - Intergenic
1006580274 6:35073084-35073106 GGCGGATTTTTGCAGGTCATGGG + Intronic
1016533291 6:145082762-145082784 GCTGGATTATTGCTAGTCATTGG + Intergenic
1024655537 7:51448465-51448487 GCCGGAGTTCTGCAAGGCACAGG + Intergenic
1030714153 7:112789351-112789373 GCCGGATTTTTGCTAGTCACTGG - Intronic
1031965535 7:128025604-128025626 GCTGCATTTTTGGTACTCACGGG + Intronic
1041483767 8:58351519-58351541 GCTGGATTCTTGCTAGTTATGGG - Intergenic
1042345275 8:67720356-67720378 GGCGGATATGTGCAAGTCACAGG + Intronic
1045263341 8:100596762-100596784 GCCTGATTCTGGGTAGTCACAGG + Exonic
1048115065 8:131511749-131511771 GCCAGATATTTGCTAGTCACAGG - Intergenic
1052573081 9:30254072-30254094 GCAGGAATTTTGGTAGTCACCGG - Intergenic
1057523063 9:95775432-95775454 CCCGCATTTTTGCTGGTCACAGG - Intergenic
1059281603 9:113138777-113138799 GCCTGATTTCTGCTTATCACAGG + Intergenic
1060451699 9:123748682-123748704 GCCTGATCTTTGCTTTTCACTGG - Intronic
1190212829 X:48461231-48461253 AGGGGATTTTGGCTAGTCACAGG - Intronic
1190966651 X:55307516-55307538 GCTGGATTTTCCCTAGCCACTGG - Intergenic
1195841929 X:109183747-109183769 GGCGTATATGTGCTAGTCACCGG - Intergenic