ID: 1030714208

View in Genome Browser
Species Human (GRCh38)
Location 7:112789942-112789964
Sequence AACGTGGCGCCCAGTTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030714199_1030714208 9 Left 1030714199 7:112789910-112789932 CCACCATCCTCTGCCTCGGAGAA 0: 1
1: 0
2: 4
3: 28
4: 369
Right 1030714208 7:112789942-112789964 AACGTGGCGCCCAGTTGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 46
1030714202_1030714208 -4 Left 1030714202 7:112789923-112789945 CCTCGGAGAACGCGACCACAACG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1030714208 7:112789942-112789964 AACGTGGCGCCCAGTTGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 46
1030714201_1030714208 2 Left 1030714201 7:112789917-112789939 CCTCTGCCTCGGAGAACGCGACC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1030714208 7:112789942-112789964 AACGTGGCGCCCAGTTGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 46
1030714200_1030714208 6 Left 1030714200 7:112789913-112789935 CCATCCTCTGCCTCGGAGAACGC 0: 1
1: 0
2: 1
3: 15
4: 204
Right 1030714208 7:112789942-112789964 AACGTGGCGCCCAGTTGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030714208 Original CRISPR AACGTGGCGCCCAGTTGAGG GGG Intronic
900227044 1:1537838-1537860 GACGTGGCGCCCCGTGGAGAGGG - Intronic
903730514 1:25491592-25491614 AACGTGGGCCCCTGGTGAGGTGG + Intronic
921130659 1:212216788-212216810 AACGTGGAGGCCAGGTGCGGCGG - Intergenic
1062899772 10:1134289-1134311 GACGTGGTGCCCAGGTGAGAGGG - Intergenic
1063569897 10:7205791-7205813 TAAGTGGTTCCCAGTTGAGGGGG - Intronic
1067356365 10:45532050-45532072 GTCGTGGAGCCCAGATGAGGTGG - Intronic
1082959738 11:58906853-58906875 AACGCGGTGCTCATTTGAGGCGG + Intronic
1087732467 11:101794598-101794620 AACATGTCGGCCAGTTGCGGTGG - Intronic
1089950124 11:122517989-122518011 AAGGTGGAGCCCAGCTGTGGAGG - Intergenic
1092012750 12:5128675-5128697 AAAGTAGCCCCCATTTGAGGAGG - Intergenic
1098961822 12:76746731-76746753 AACATGGCTCCAAGTTGAGTGGG + Intergenic
1099531258 12:83784444-83784466 TTAGTGGCGCCCAGTGGAGGTGG + Intergenic
1103648778 12:122416920-122416942 AACATGGTGCCCAGGTGTGGTGG + Intronic
1120855569 14:89209192-89209214 AACGTGGCCGCCAGATAAGGTGG - Intronic
1122352422 14:101103757-101103779 AACGTGGCGCCCAGCTGCCGCGG - Intergenic
1122947057 14:105016603-105016625 GACGTGGAGCTCAGTGGAGGAGG - Intronic
1127225007 15:56919005-56919027 AAAGGGGCGCGGAGTTGAGGCGG - Intronic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1136005097 16:27324016-27324038 AAAGTTGCACCCAGTTGGGGAGG + Intronic
1140198776 16:72877855-72877877 CCCGTGGCCCCCAGTTAAGGGGG - Intronic
1143731882 17:8886155-8886177 AACGTGGAGCTCTGTGGAGGTGG - Intronic
1144834964 17:18151938-18151960 CACCTGGCACCCAGGTGAGGGGG + Exonic
1145968696 17:28941007-28941029 AAGGAGGAGCCCAGTGGAGGGGG + Intronic
1152584850 17:81184341-81184363 AAGGTGGCGCCTGGCTGAGGAGG - Intergenic
1152704002 17:81833511-81833533 AACGTGACTCCCAGGTGAGGGGG - Exonic
1159688767 18:71458939-71458961 AAAGTGGGGCACAGTTCAGGAGG - Intergenic
1161512471 19:4679303-4679325 AACGTGGGGCTCAGTCTAGGTGG - Intronic
927637832 2:24828870-24828892 AACCTGGCACCCAGGTGTGGAGG - Intronic
927781898 2:25946265-25946287 AAGGTGGGGGCCAGGTGAGGTGG + Intronic
947885562 2:233566733-233566755 ATGGCGGCGCCCAGTTGGGGCGG - Intronic
948093644 2:235316245-235316267 AAAGTGCCGCCCAGGTGCGGTGG + Intergenic
1169437694 20:5607669-5607691 AACATGGCGGCCAGGTGTGGTGG + Intronic
1172026327 20:31951469-31951491 AAGGTGGCGCCCTGTTTATGGGG - Intronic
1177029208 21:15961443-15961465 AATGTGTTGGCCAGTTGAGGTGG + Intergenic
949499652 3:4667536-4667558 AACAGGGAGCCCAGGTGAGGCGG + Exonic
961698804 3:128726070-128726092 AACGTGACGCAAGGTTGAGGCGG + Intergenic
985089055 4:186344637-186344659 AAACTGGCGGCCAGGTGAGGTGG - Intergenic
1000619693 5:163469660-163469682 AACGTGGTGCCCAGGACAGGCGG + Exonic
1007701339 6:43768258-43768280 AGCATGGAGCCCAGGTGAGGAGG + Intergenic
1013514522 6:110874104-110874126 AACGTGGCGCCCAGCCTTGGAGG - Intronic
1019743550 7:2687731-2687753 AACGAGGCCACCAGGTGAGGAGG - Intronic
1026994405 7:74606289-74606311 GAGGTGGTGGCCAGTTGAGGAGG - Intergenic
1027201175 7:76064740-76064762 AACGTGACGCCCAGGTGAGCCGG - Intronic
1028775426 7:94670475-94670497 GAAGTGGGGCCCAGATGAGGAGG - Intergenic
1030714208 7:112789942-112789964 AACGTGGCGCCCAGTTGAGGGGG + Intronic
1032378358 7:131447939-131447961 AAAGTGGCGGCCACGTGAGGTGG + Intronic
1036042593 8:5102437-5102459 AACATGAAGCCCAGTTTAGGTGG - Intergenic
1037345645 8:17897943-17897965 AACTTGACTCCCAGTTCAGGAGG + Intronic
1046829626 8:118730307-118730329 AACATGGGGCACAGTGGAGGAGG - Intergenic
1054077079 9:60546510-60546532 CTCGTGGCGCCCAGTGCAGGCGG - Intergenic