ID: 1030717733

View in Genome Browser
Species Human (GRCh38)
Location 7:112830071-112830093
Sequence CCTAGGGAGTTGAGAGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030717733_1030717737 16 Left 1030717733 7:112830071-112830093 CCTAGGACTCTCAACTCCCTAGG 0: 1
1: 0
2: 0
3: 14
4: 187
Right 1030717737 7:112830110-112830132 AGAATCACCTGAACTCTGCTTGG No data
1030717733_1030717738 17 Left 1030717733 7:112830071-112830093 CCTAGGACTCTCAACTCCCTAGG 0: 1
1: 0
2: 0
3: 14
4: 187
Right 1030717738 7:112830111-112830133 GAATCACCTGAACTCTGCTTGGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030717733 Original CRISPR CCTAGGGAGTTGAGAGTCCT AGG (reversed) Intronic
903811444 1:26036978-26037000 CCAAGGCAGTTCAGTGTCCTGGG - Intergenic
905345523 1:37308725-37308747 GCTAGGGAGCTGAGCTTCCTTGG - Intergenic
906300778 1:44680097-44680119 CCTGGGGAGTTGAGAGTGCAAGG + Intronic
907393206 1:54172117-54172139 CTTAAGGAGTAGAGAGTCCGGGG - Intronic
912372858 1:109187247-109187269 CTCAGGGAGAGGAGAGTCCTAGG - Intronic
912967658 1:114250320-114250342 ATTATGGAGTAGAGAGTCCTTGG + Intergenic
913365009 1:118027986-118028008 ACTTGGGAGTTGAGTGACCTTGG + Intronic
914903618 1:151726494-151726516 CTTGGGGAGTTGGGAGGCCTTGG + Intronic
915819092 1:159002824-159002846 CCTAGGAAGTAGAGATTCCCAGG - Intronic
917708543 1:177659636-177659658 CCTAGGGAGGTCAGAGAACTTGG + Intergenic
920125365 1:203690035-203690057 TTTAGGGAGCTGAGATTCCTTGG + Intronic
920337472 1:205254824-205254846 CCGAGTGAGCTGAGAGCCCTGGG - Intronic
920706117 1:208251850-208251872 CCTTGGGAGTCGGGAGACCTGGG + Intergenic
921010040 1:211132986-211133008 CCTTGAGAGGCGAGAGTCCTAGG - Intronic
921541733 1:216424443-216424465 CCTAGGGATTTGGGAGGCCAAGG + Intergenic
921584546 1:216931628-216931650 CCAAGGGTGTTCAGAGTCCCAGG - Intronic
923460808 1:234207749-234207771 CCTAGTGCTTTGAGAGTCCAAGG + Intronic
1062984164 10:1752098-1752120 CAGAGGCAGTTGGGAGTCCTTGG - Intergenic
1063031629 10:2240859-2240881 CCCATGGAGCTGAGTGTCCTGGG - Intergenic
1064552661 10:16520075-16520097 TCTGGGGAGTGGAGAGGCCTGGG - Intronic
1065161877 10:22930735-22930757 CCTAGGAAGTAGAAAATCCTTGG - Intronic
1065883530 10:30058424-30058446 CTTAAGGAGTAGAGAGGCCTTGG - Intronic
1067565145 10:47331053-47331075 CCTAGGGAGGGGAGAGTCCAGGG - Intergenic
1068103027 10:52580418-52580440 CTGAGGGAATTGAGAGTCCAAGG - Intergenic
1070158562 10:73851508-73851530 CTGAGGGAGTGGAGAGTTCTGGG - Intronic
1070713622 10:78701627-78701649 CCTAGGGAGCTCACAGTCCAGGG + Intergenic
1075158984 10:120006175-120006197 GCTCAGGTGTTGAGAGTCCTTGG - Intergenic
1077285196 11:1762469-1762491 CCCAGGGACTTGAGAGTACAAGG + Intronic
1077422865 11:2461088-2461110 CCTGGGGTGTTGAGAGGCCCTGG + Intronic
1078438700 11:11346325-11346347 TCTAGGAATCTGAGAGTCCTGGG + Intronic
1084536129 11:69758315-69758337 CCCAGGCAGCTGAGGGTCCTTGG + Intergenic
1085390093 11:76177829-76177851 CCTAGGGAGATGGGAGGCCTTGG + Intergenic
1085922968 11:80981072-80981094 CCCAGGGGGTTGGGAATCCTTGG + Intergenic
1087953438 11:104254519-104254541 ACTATGGAGCTGAGAGGCCTGGG - Intergenic
1088841493 11:113630959-113630981 CCCATGGGGTTGAGAGTCTTTGG - Intergenic
1089536135 11:119161725-119161747 CCTGGGGATTGGAGAGGCCTGGG + Exonic
1090589203 11:128247022-128247044 CCTCGAGTGATGAGAGTCCTGGG + Intergenic
1092290598 12:7157683-7157705 CCCATGGAGGTGAGAGGCCTGGG + Exonic
1092934355 12:13346863-13346885 CCTAGGTACTTCAGAATCCTTGG + Intergenic
1093785351 12:23186086-23186108 CGTGGGCAGTTGAGACTCCTTGG + Intergenic
1094553866 12:31478492-31478514 CCTAGGATTTTGAGAGTCCAGGG + Intronic
1095578286 12:43764515-43764537 CCTAAAGAACTGAGAGTCCTGGG + Intronic
1096187805 12:49594095-49594117 CCTTGGGGGTTGAATGTCCTGGG - Intronic
1101300397 12:103473829-103473851 CTCAGGGAGCTGAGAGTCTTGGG - Intronic
1102957147 12:117066137-117066159 CCTAGGGAGGAGAGGGTCCTTGG - Intronic
1103061431 12:117861686-117861708 CCTAAAGAATTGGGAGTCCTCGG - Intronic
1103500642 12:121399517-121399539 CCTTGGGATTTGAGAGCCCTTGG + Intronic
1105205136 13:18216910-18216932 ACTTGGGAGTTCAGAATCCTGGG + Intergenic
1105565027 13:21537214-21537236 CCTAGGGAGTTAACAGTGTTAGG - Intronic
1106548625 13:30752240-30752262 CCTGGAGAGGTGAGAGCCCTCGG + Intronic
1108304091 13:49113373-49113395 GCTAGGGAGATGAGAGAGCTAGG - Intronic
1114592884 14:23884346-23884368 GTTAGGAAGTTTAGAGTCCTGGG + Intergenic
1115731291 14:36272334-36272356 CCGCGGGAGTCGGGAGTCCTGGG - Intergenic
1117543675 14:56772678-56772700 CCTAGGCAGAAGAGAGTCCATGG + Intergenic
1117803335 14:59466044-59466066 CCTACGGGGTTTAGAGTCATGGG - Intronic
1119965385 14:78909696-78909718 CCTAAAGAATTGAGGGTCCTGGG - Intronic
1120345603 14:83285705-83285727 CCTAAGGAACTGAGGGTCCTGGG - Intergenic
1121743029 14:96267260-96267282 CCTGGGGAGGAGAGAGTCCGTGG + Intronic
1126069757 15:44855907-44855929 ACAAGGGACTTGAGAATCCTTGG + Intergenic
1126088772 15:45033255-45033277 ACAAGGGACTTGAGAATCCTTGG - Intronic
1126477370 15:49079733-49079755 CCTAAGGAGTTCTGCGTCCTGGG - Intergenic
1128227481 15:66012340-66012362 ACTAGGGAGCGGAGAGCCCTGGG - Intronic
1128261405 15:66235578-66235600 CCTGGGTAGTTGAGACCCCTGGG - Intronic
1133722051 16:8503700-8503722 CCTAAAGAACTGAGAGTCCTGGG + Intergenic
1133779157 16:8923723-8923745 CCAAGTGAGTGGAGAGACCTTGG + Intronic
1139179851 16:64734009-64734031 CCTAAAGAACTGAGAGTCCTAGG - Intergenic
1140781766 16:78303450-78303472 ACTAGGGAGTTGAGTGAGCTTGG + Intronic
1140868658 16:79087002-79087024 CCTAGGGAATGGAGATACCTGGG + Intronic
1142030100 16:87834342-87834364 CGAAGGGAGTTGAGAGGCGTCGG - Intronic
1142197308 16:88744827-88744849 ACTAGGGAGCTGAGAGTCCGAGG + Intronic
1144666794 17:17107551-17107573 CCTCTGGAGTTCAGTGTCCTGGG + Intronic
1144862135 17:18311682-18311704 CCTTTGGAGTTTAGAGTCCAAGG + Intronic
1144957613 17:19027103-19027125 GCAAGGGAGCTGAGAGGCCTGGG + Intronic
1144977543 17:19147413-19147435 GCAAGGGAGCTGAGAGGCCTGGG - Intronic
1145976557 17:28987285-28987307 CTGAGGGAGCTGAGAGTGCTTGG + Intronic
1146085808 17:29828382-29828404 CCTAGGGAGTTTTGAGTGGTTGG - Intronic
1146241949 17:31238148-31238170 CCTAGAGAGTTAAAACTCCTAGG + Intronic
1146903429 17:36602453-36602475 GCTAGGGGGATGAGAGTTCTGGG - Intronic
1147330854 17:39698599-39698621 CCTAGGGAGTTGAGAAACAGGGG - Intronic
1149686924 17:58541171-58541193 CCTGGGGAGGAGAGAGCCCTGGG - Intergenic
1150173298 17:63022658-63022680 CCAAGGTATTTGAGAGACCTTGG + Intronic
1151490097 17:74427690-74427712 CCTGGGGAGTGGAGAGCCCTAGG - Intronic
1151566701 17:74902539-74902561 CCTAGGGTGCTGAGGGGCCTGGG - Intergenic
1153434171 18:5050839-5050861 TATTCGGAGTTGAGAGTCCTGGG - Intergenic
1155601716 18:27556375-27556397 CCTAAAGAATTGAGGGTCCTAGG - Intergenic
1155982394 18:32194896-32194918 CCTAGAGAATAGAGATTCCTTGG - Intronic
1156696376 18:39773075-39773097 CCTAGGGAAGTGAGGGTCATAGG + Intergenic
1156888362 18:42161803-42161825 CCTAAAGAACTGAGAGTCCTGGG + Intergenic
1159112621 18:64076805-64076827 GCCAGTGAGTTGAGAGTGCTGGG - Intergenic
1159773332 18:72574990-72575012 GCAAGGGAGTTGAGAGTGTTTGG + Intronic
1161433562 19:4248555-4248577 GCTGGGGAGTTGGGACTCCTCGG + Intronic
1163493162 19:17629165-17629187 CCTGGGGAGAAGGGAGTCCTGGG + Intronic
1163646506 19:18492685-18492707 CCTTGGTAGTTGAGAGGTCTGGG - Intronic
1163672579 19:18637367-18637389 CCTAGGGACCTGAGAATCCTGGG + Intronic
1164384735 19:27763066-27763088 CCTAGGCAGGTGAGATTCCTGGG - Intergenic
1166171134 19:41028224-41028246 CATATGGACTTGAGAGTCTTGGG + Intergenic
1166503314 19:43356344-43356366 CCTAGGGAAGTGGGAGACCTAGG - Intronic
1166507140 19:43378417-43378439 CCTAGGGAAGTGGGAGACCTAGG + Intergenic
1167325143 19:48819784-48819806 CTTGGGGAGTTTACAGTCCTGGG - Intronic
929670966 2:43876219-43876241 CCGAGGGAGCTGAGAGGCCACGG - Intronic
930507157 2:52297737-52297759 CTTAGGGAATAGAGAGGCCTGGG - Intergenic
930991896 2:57666197-57666219 GCTAGGGAGTAGGGAGGCCTTGG + Intergenic
932299100 2:70652679-70652701 CAGATGGAGCTGAGAGTCCTGGG - Intronic
934219141 2:90065350-90065372 CCTAGGGGGATGAGTGTCCCTGG + Intergenic
935328912 2:101962145-101962167 CTTGGGCAGTTGAGAGGCCTTGG + Intergenic
936837585 2:116726911-116726933 GCCAGGGAGATGAGAGACCTAGG + Intergenic
940665345 2:156601935-156601957 CCAAAGGAGTTTAGAGTTCTAGG - Intronic
941004565 2:160234874-160234896 CCTAAGGAACTGAGAGTCCTGGG - Intronic
941731681 2:168924759-168924781 TCTAGAGAGTTGAGACCCCTGGG + Exonic
946038440 2:216763549-216763571 CCTAGGGAGTAGTGAGCCTTGGG - Intergenic
946413430 2:219527022-219527044 GCAAAGGAGTTGAGAGTCCAGGG - Intronic
1172359330 20:34301368-34301390 CCTTTGGAGTTGAGGGTCCCAGG - Intronic
1173537141 20:43824188-43824210 CACTGGGAGTTGAGATTCCTGGG + Intergenic
1173840352 20:46152984-46153006 CCTAGGGCTTTGGGAGGCCTAGG - Intergenic
1179647727 21:42785459-42785481 CCTGGGGAGTTCAGGATCCTAGG - Intergenic
1181726538 22:24814954-24814976 CCTAAGGAGCTCAGAGTCCCTGG + Intronic
1184784546 22:46665380-46665402 CCTAGGGAGAAGCGTGTCCTGGG - Intronic
949260671 3:2099478-2099500 CCTGGGGAGTGGAGGGACCTGGG + Intronic
953073045 3:39542390-39542412 CCTAGGGACTGGAGAATTCTAGG + Intergenic
953606981 3:44418729-44418751 TCTTGGGAGTCGAGTGTCCTTGG - Intergenic
953675304 3:44996707-44996729 CCTAGGAAACTGAGAGGCCTAGG - Intronic
958481956 3:94654260-94654282 CCTAGGGAGCTTAGAGTATTAGG + Intergenic
960097776 3:113704232-113704254 CCTAAAGAACTGAGAGTCCTGGG + Intergenic
960992228 3:123319510-123319532 CCTAGAGAGATGCGAGTTCTAGG - Intronic
961864768 3:129945617-129945639 ACTGGGGAGTTGAGACTCCCGGG - Intergenic
966602755 3:181791407-181791429 CCTAGAGAATTCAGTGTCCTCGG - Intergenic
971878144 4:32330685-32330707 CCTAAGGAACTGAGCGTCCTGGG - Intergenic
973936947 4:55855719-55855741 CCTAGGGAGAAGAGAATTCTAGG + Intronic
974488693 4:62535999-62536021 CCCAGGGAGTTGAGAGTATTTGG - Intergenic
975264432 4:72345012-72345034 CATAGGGAGTAAAGAGTACTGGG - Intronic
976836325 4:89378692-89378714 CCTATAGAGCTGAGGGTCCTGGG - Intergenic
979156701 4:117401427-117401449 CCTAGGGAGATGAGCATCCCTGG - Intergenic
979300515 4:119081202-119081224 CCCAGGGAGCTGACAGTTCTAGG + Intergenic
981806964 4:148727880-148727902 CCTTGGGCTTTCAGAGTCCTGGG + Intergenic
981910575 4:149976618-149976640 CCTAAGGAATTGAGGGTTCTGGG + Intergenic
982235317 4:153246779-153246801 CCGAGGGTGTTGTGAGCCCTTGG - Intronic
983060654 4:163155572-163155594 CCTAGGCAGTTAAGCTTCCTTGG - Intronic
984421488 4:179528066-179528088 CCTAGAGAGCCAAGAGTCCTGGG + Intergenic
987065550 5:14286398-14286420 CCTGGGGTGCTGGGAGTCCTGGG + Intronic
987937160 5:24480961-24480983 CATAGGGAGTTTGGGGTCCTAGG + Intergenic
989126100 5:38053638-38053660 ATAAGGGAGTTGAGCGTCCTCGG - Intergenic
989786780 5:45342060-45342082 CCTAAAGAATTGAGGGTCCTGGG - Intronic
989975222 5:50577724-50577746 CCTAAAGAACTGAGAGTCCTGGG + Intergenic
990603718 5:57386311-57386333 GCCAGGGAGCAGAGAGTCCTGGG + Intergenic
995549459 5:113266433-113266455 CCTTGGGAGTTGGCAGTTCTTGG + Intronic
998346102 5:141465280-141465302 CCTAAAGAACTGAGAGTCCTGGG + Intronic
998579299 5:143354502-143354524 CTCAGGGATTTGAGAGTCCCAGG + Intronic
998835599 5:146200276-146200298 CCTAAAGAACTGAGAGTCCTGGG - Intergenic
999253350 5:150195634-150195656 GCTAGGGAGGAGATAGTCCTGGG - Intronic
1001604157 5:172948145-172948167 CCCAGGGAGTGGAGAGGACTGGG - Intronic
1001672694 5:173487278-173487300 CCTAGGTAGTTGAGACTCTTTGG + Intergenic
1002202192 5:177536161-177536183 CCTAGCGCTTTGGGAGTCCTAGG - Intronic
1005298653 6:24449964-24449986 CCCAGGGAGTAGAGAGGCCTGGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007889130 6:45270227-45270249 CCTAAAGAACTGAGAGTCCTGGG + Intronic
1009520362 6:64674622-64674644 CCTAAGGAATAGAAAGTCCTTGG + Intronic
1010099471 6:72087254-72087276 CCTAAAGAACTGAGAGTCCTGGG + Intronic
1011315683 6:86028234-86028256 CCTAGGAAGCTCATAGTCCTGGG - Intergenic
1012856017 6:104502674-104502696 CCCACAGAGTTGAGAGTCCATGG - Intergenic
1013393845 6:109714009-109714031 CCTAGGGGGATGAGTGTCCCTGG + Intronic
1014027471 6:116665839-116665861 CCCAGCAAGTTGAGAGTCCGAGG - Intronic
1015415963 6:132948924-132948946 CCTTGGGAGGGGAGGGTCCTGGG + Intergenic
1015861191 6:137682020-137682042 CCTAGGACTTTGAGAGTCCAAGG - Intergenic
1016581957 6:145637900-145637922 CCTAGTGAGGTGATAGTGCTGGG + Intronic
1017256539 6:152339996-152340018 CCCAGGGAGTTGACATTCTTAGG + Intronic
1017344057 6:153358619-153358641 CCTAAGGAACTGAGGGTCCTGGG - Intergenic
1018820668 6:167371509-167371531 CTTGGTGAGTTTAGAGTCCTGGG + Intronic
1019153861 6:170026026-170026048 CCTAAGGAGCTGCGAGTCCCTGG + Intergenic
1019570406 7:1708802-1708824 CCGAGGGAGTTGCCAGACCTGGG - Intronic
1020683331 7:11263580-11263602 CCCAGGAAGTTGAGAGAACTAGG - Intergenic
1021055562 7:16042504-16042526 CCCAGGGATTGGAGACTCCTGGG + Intergenic
1021345011 7:19516778-19516800 GCTAGAGAGTTGGGAGTCATGGG - Intergenic
1022442864 7:30448153-30448175 GCCCAGGAGTTGAGAGTCCTGGG - Intronic
1027712155 7:81618088-81618110 CCTAAAGAACTGAGAGTCCTAGG + Intergenic
1027795460 7:82687589-82687611 TGTAGGAAGTTGAGAGGCCTGGG + Intergenic
1030717733 7:112830071-112830093 CCTAGGGAGTTGAGAGTCCTAGG - Intronic
1031349873 7:120717795-120717817 CCTTGGGAATTGAGTGTACTTGG - Intronic
1035309279 7:157954757-157954779 CCCATGCAGTTGAGTGTCCTGGG + Intronic
1036725337 8:11215794-11215816 CCTAAGGATGTGAGAGTTCTGGG + Intergenic
1037661519 8:20931420-20931442 CCTAGAGAATTGAGGCTCCTGGG + Intergenic
1038046713 8:23771844-23771866 ACAAGGGAGTTGAGAGTGATGGG + Intergenic
1044144889 8:88700439-88700461 CCTAGTCCTTTGAGAGTCCTAGG + Intergenic
1044238293 8:89856991-89857013 CCTTGGGAGTTGTGGGGCCTTGG - Intergenic
1045440218 8:102201671-102201693 CTCAGGGAGCTGAGAGTCCAGGG - Intergenic
1048367247 8:133749016-133749038 CCTAGGTAGTTGGGAGTCTGAGG + Intergenic
1049974619 9:849659-849681 CCTGTGGAGTTGACAGACCTTGG + Intronic
1056613924 9:88145541-88145563 CCTATGGAGTTAAGAGGTCTAGG - Intergenic
1060120355 9:120983437-120983459 CCTGGGGAGTGGAGCCTCCTGGG - Intronic
1060886150 9:127153945-127153967 CCAAGGGAGTTGAGTCTCATGGG + Intronic
1061297047 9:129682432-129682454 GCTAGGGAGATGAGCGTCCTTGG - Intronic
1062594660 9:137293903-137293925 CCTTGGGAGTTGAAAGAGCTGGG + Intergenic
1186337838 X:8610111-8610133 CCTAAAGAATTGAGGGTCCTGGG - Intronic
1186839423 X:13470159-13470181 ACTAGGGAGTTAGGAGGCCTGGG + Intergenic
1187288035 X:17925006-17925028 CCTAGGGAGATGAAATACCTTGG + Intergenic
1190034956 X:47013562-47013584 CCTAGAGAACTGAGCGTCCTGGG + Intronic
1192170594 X:68852172-68852194 CCTTGGAAGCAGAGAGTCCTGGG - Intergenic
1192214180 X:69146733-69146755 ACTTGGGAGCTAAGAGTCCTGGG + Intergenic
1196584012 X:117408930-117408952 CCTAGGGAGATGGGTGTCCCTGG - Intergenic
1198656130 X:138915028-138915050 TCCAGGGAGTTGACATTCCTAGG + Intronic
1199949152 X:152692401-152692423 CCTAAAGAACTGAGAGTCCTGGG + Intergenic
1199960524 X:152776048-152776070 CCTAAAGAACTGAGAGTCCTGGG - Intergenic
1201708723 Y:16966013-16966035 CCCTGGGAGTTGATACTCCTGGG - Intergenic