ID: 1030717774

View in Genome Browser
Species Human (GRCh38)
Location 7:112830550-112830572
Sequence ATGTATATCTTGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030717771_1030717774 -6 Left 1030717771 7:112830533-112830555 CCTGAAGAACATCTCTCATGTAT 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1030717774 7:112830550-112830572 ATGTATATCTTGAGGAAGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 252
1030717770_1030717774 -5 Left 1030717770 7:112830532-112830554 CCCTGAAGAACATCTCTCATGTA 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1030717774 7:112830550-112830572 ATGTATATCTTGAGGAAGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030717774 Original CRISPR ATGTATATCTTGAGGAAGGA AGG Intronic
906078935 1:43071022-43071044 ATGTTTGTCTTGAGGAATAAAGG + Intergenic
907009544 1:50950770-50950792 TAGTAGATCTTCAGGAAGGAAGG - Intronic
907681875 1:56571973-56571995 CTGTATTTGCTGAGGAAGGAAGG - Intronic
907980417 1:59474935-59474957 AAGTATATCATGAGGATGAAAGG + Intronic
910443465 1:87276777-87276799 ATGTATATGCTGGGGATGGAGGG + Intergenic
911190210 1:94941064-94941086 ATGTATATGTTGATGAAGGTAGG - Intergenic
911536170 1:99103603-99103625 ATGTTTATTTTGGGGAATGATGG + Intergenic
911559255 1:99383922-99383944 ATGTATTACTTGAATAAGGAGGG - Intergenic
911888925 1:103342075-103342097 ATGTAGATCTTGAAGAAGGCAGG + Intergenic
912189299 1:107318929-107318951 CTGTATATCTTCAGACAGGAAGG - Intronic
914803942 1:150979033-150979055 ATGTACAACATGGGGAAGGAAGG + Intergenic
915149545 1:153819232-153819254 ATGTATATCTAGAGGAAATGTGG - Intronic
915308130 1:154992887-154992909 ATGTGTATCTGGAGCAGGGAGGG - Exonic
915543891 1:156585054-156585076 ATGTGTATCCCCAGGAAGGAGGG + Intronic
916827092 1:168452902-168452924 CTGTGTATGTTGAGGAAGAAGGG - Intergenic
916926398 1:169525414-169525436 ATTTATATCTTGATCAAGGAAGG + Intronic
919801748 1:201358629-201358651 AGGGAGCTCTTGAGGAAGGAAGG - Intergenic
922447066 1:225706639-225706661 TTGTATATCTGTAGAAAGGAAGG + Intergenic
1063226399 10:4019050-4019072 ATGTATATTTGGAAGAGGGAGGG + Intergenic
1065762525 10:28995438-28995460 ATGTAAATATTGAAGAAGCATGG - Intergenic
1066310870 10:34195001-34195023 TGGTATATCTTGAGATAGGAAGG - Intronic
1067305249 10:45058123-45058145 ATTTAGATCTGGAGGAAGAAGGG - Intergenic
1072587021 10:96791746-96791768 ATGTATTTCTTAAGTAATGATGG + Intergenic
1073236855 10:102024119-102024141 CTGTATTTCTAGTGGAAGGAGGG - Intronic
1074708075 10:116153310-116153332 ATGTATAAAGGGAGGAAGGATGG - Intronic
1076829674 10:132988081-132988103 AAATATATCTTGATGAAGAATGG - Intergenic
1077831251 11:5873635-5873657 GTCTATATCTTGAGAAAGAAGGG + Intronic
1078748515 11:14138170-14138192 ATGTCTTTCTTGAGAAAAGAGGG - Intronic
1079794423 11:24781893-24781915 ATGAATATTCTGATGAAGGATGG + Intronic
1080371891 11:31657733-31657755 ATGTATGACTTTGGGAAGGAAGG - Intronic
1083248113 11:61445803-61445825 GTGTATATTTAGAAGAAGGATGG + Intronic
1085730352 11:78992584-78992606 ATGTGGATCTTGAGAAAGAACGG + Intronic
1085825638 11:79844192-79844214 ATGTATATCAGAAGGCAGGAGGG - Intergenic
1085888699 11:80552035-80552057 ATGTTTATCTGGAGCATGGAAGG + Intergenic
1087339210 11:96881229-96881251 ATGTGTCTCATGAGGAAAGAAGG - Intergenic
1091061616 11:132468330-132468352 ATAGGTATCTTGAGAAAGGATGG - Intronic
1092836372 12:12492910-12492932 AAGTAAATATTGAGGAAGGAAGG - Intronic
1093587875 12:20863488-20863510 AGGTATATCTGTAGGAAGGAGGG - Intronic
1093601074 12:21023890-21023912 AGGTACATCTGTAGGAAGGAGGG - Intronic
1095622079 12:44268892-44268914 ATGGCTATCTTAAGGGAGGAGGG - Intronic
1097475874 12:60055184-60055206 ATGTGTATCATCAGGAAGCAAGG - Intergenic
1098146439 12:67502495-67502517 ATGCATCTCTTGGGAAAGGAAGG - Intergenic
1098869750 12:75803313-75803335 GTGTCTGTCTTGAGGAAGAAAGG + Intergenic
1098920544 12:76298217-76298239 ATATACATCTTCAGGAAGGTGGG - Intergenic
1106587120 13:31067218-31067240 ATGCATTTCATGAGGAAGAAAGG - Intergenic
1107443849 13:40452475-40452497 ATGTATATCCTGAGGCTTGAAGG + Intergenic
1108789652 13:53952256-53952278 ATGTATTTCTAGAGGAAAAATGG - Intergenic
1109090930 13:58044430-58044452 TTATATATCATGATGAAGGAAGG - Intergenic
1109268252 13:60225307-60225329 CTGTGTATCTGGAGGAAGAAAGG - Intergenic
1109903332 13:68803578-68803600 ATATATTTTTTGAGGGAGGATGG - Intergenic
1110801085 13:79695885-79695907 ATGTATATGTTTAGGGAAGAAGG + Intergenic
1111386191 13:87531086-87531108 ATCTATATATGGAAGAAGGAAGG + Intergenic
1112028706 13:95437692-95437714 TTGTATTCCTGGAGGAAGGATGG + Intronic
1112927085 13:104689470-104689492 ATAAATATCTGGAGGAATGAAGG + Intergenic
1113557384 13:111249278-111249300 AGGTATATTCTGGGGAAGGATGG - Intronic
1114170476 14:20267672-20267694 ACGTATATCTTGACCAAGTAAGG + Intronic
1115887686 14:37992024-37992046 ATCTCTGTCTTCAGGAAGGAAGG + Intronic
1116750969 14:48883049-48883071 ATGGATATCTGGAGGATGGTGGG - Intergenic
1118066412 14:62196052-62196074 AAGTCTATCATTAGGAAGGATGG - Intergenic
1118157742 14:63257636-63257658 AGGAATATGGTGAGGAAGGAAGG - Intronic
1119374384 14:74177643-74177665 TTTTATATCTTGAGCTAGGATGG + Intronic
1120863304 14:89274277-89274299 ATGGAAATCATGAGAAAGGAAGG + Intronic
1121037409 14:90717872-90717894 ATGTATCTGTTGGGGAAGCAGGG - Intronic
1121481695 14:94282813-94282835 ATATATATCTTCATGAAGGAAGG + Exonic
1121888939 14:97571512-97571534 ATGTGTATATTGAGGAGGGGCGG - Intergenic
1121939121 14:98052519-98052541 AGATTTATCTTGTGGAAGGAAGG - Intergenic
1125220291 15:37324911-37324933 TTGTATATATGGAGTAAGGAAGG - Intergenic
1128015731 15:64344026-64344048 ATTTATTTATTGGGGAAGGAAGG - Intronic
1128947747 15:71841557-71841579 ATATAAATCTTGACCAAGGAGGG - Intronic
1129424958 15:75455920-75455942 ATTTATATTTTTTGGAAGGAGGG - Intergenic
1130281058 15:82520480-82520502 ATGTCTATGTTGAGGGAGTAAGG - Intergenic
1130594726 15:85241297-85241319 ATGTCTATGTTGAGGGAGTAAGG - Intergenic
1133538780 16:6727644-6727666 ATTTCTACCTTAAGGAAGGAGGG - Intronic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1137540038 16:49355830-49355852 ATGTATCCCATGAGGAGGGATGG - Intergenic
1137910064 16:52368893-52368915 ATGGCTAGCTGGAGGAAGGATGG - Intergenic
1139002236 16:62526362-62526384 ATGTATATATGGTGGATGGAGGG - Intergenic
1139744048 16:69060085-69060107 ATGGATAGCTGGGGGAAGGAAGG - Intronic
1140613273 16:76627123-76627145 ATGTGTACATTGAGGAAGGATGG + Intronic
1140652694 16:77106005-77106027 ATTTATAATTTGTGGAAGGAGGG - Intergenic
1141471986 16:84245047-84245069 ATGTATGTCCTGTGGAGGGAGGG - Intergenic
1143424111 17:6819510-6819532 ATGTTTATTTGCAGGAAGGAAGG + Intronic
1144255940 17:13467175-13467197 ATATATATATATAGGAAGGAAGG - Intergenic
1144335662 17:14266986-14267008 ATGCATATGAGGAGGAAGGAAGG - Intergenic
1146496292 17:33325429-33325451 ATGGAGATCTTGAGGCAGAAAGG + Intronic
1149965077 17:61154175-61154197 ATGTGTCCTTTGAGGAAGGAAGG + Intronic
1151339656 17:73462658-73462680 ATGTATATGTGGTGGAAGGATGG + Intronic
1151392177 17:73794857-73794879 ATGAATATTTTGAGCTAGGAAGG + Intergenic
1153403901 18:4713446-4713468 ATGCATATCTGGTGGAAGAATGG - Intergenic
1153734472 18:8050741-8050763 ATAAGTGTCTTGAGGAAGGAAGG + Intronic
1156101890 18:33606329-33606351 ATTTATAACATGAGTAAGGAAGG + Intronic
1156507885 18:37610024-37610046 ATGGGTATTTTTAGGAAGGAGGG + Intergenic
1156671934 18:39481246-39481268 ATGTATATATTGAGAAATCAAGG - Intergenic
1157469570 18:47978862-47978884 ATGGATTTACTGAGGAAGGAGGG + Intergenic
1158188888 18:54803086-54803108 ATGTATATCTAGAAGAGGAAAGG + Intronic
1159414962 18:68134343-68134365 AGGTAAATATTGAAGAAGGAAGG + Intergenic
1159907993 18:74115663-74115685 ATGTATTTCTTTAGAAAGTATGG - Intronic
1160214962 18:76920636-76920658 ATGTATCCATTGAGGAAGGCAGG + Intronic
1162062747 19:8106864-8106886 ATGGATGTATTGAGGATGGATGG + Intronic
1162777550 19:12989112-12989134 GTGTATATGTGGATGAAGGATGG + Intergenic
1163072613 19:14856910-14856932 ATGGATCTCTTGAAGAAGGTGGG + Intergenic
1165418077 19:35707235-35707257 ATGTATATTATGAGGAGGGGAGG + Intronic
926001082 2:9333231-9333253 ATGAATAACTTAATGAAGGATGG - Intronic
926335026 2:11856693-11856715 AGGGAGAGCTTGAGGAAGGAGGG + Intergenic
926391131 2:12394095-12394117 ATGTATATCTTGATCAGGGTTGG - Intergenic
926617196 2:15008586-15008608 GTCTATACCTTGAGGAATGAGGG - Intergenic
926778738 2:16447752-16447774 ATGTTTATATTGAAGAAGGAAGG + Intergenic
928486246 2:31735356-31735378 ATGTATACCTTGAGGAAGCAGGG - Intergenic
928748524 2:34443756-34443778 AGGTCGATCTTGAGAAAGGAGGG + Intergenic
928821841 2:35371039-35371061 ATGTGTGTCTGGAGGAGGGATGG + Intergenic
929093849 2:38245597-38245619 CTGTACATCCTCAGGAAGGAAGG + Intergenic
929406103 2:41643242-41643264 ATGTGTACTTTGATGAAGGATGG + Intergenic
929887947 2:45895146-45895168 AGGTGTCTCTTGAGAAAGGAAGG + Intronic
930031764 2:47062481-47062503 ATGTCTAAATTGAGGGAGGAAGG - Intronic
930575909 2:53148736-53148758 ATTTAAGTCTTGGGGAAGGATGG - Intergenic
932454309 2:71836928-71836950 ATGAAAATGTTGAGGAAGGCAGG + Intergenic
932460055 2:71876225-71876247 ATGTCAATCTTGGGGAGGGAAGG + Intergenic
934012175 2:87833585-87833607 ATGTATAAAGTGAGGAATGACGG - Intergenic
935184845 2:100722747-100722769 ATGGATTTCTGGAGGAGGGATGG - Intergenic
935504080 2:103877892-103877914 ATGTATATGTTGGGGATAGATGG - Intergenic
937193793 2:120131870-120131892 ATGTAGATGTTTAGGAGGGAAGG + Intronic
937508034 2:122559139-122559161 ATGAATATCTTGATTAAGAAAGG + Intergenic
940487555 2:154315228-154315250 ATTAATATCCTGAGGAAGAACGG - Intronic
940708133 2:157129096-157129118 ATGTATATATTTAGGATGGTAGG - Intergenic
941700952 2:168604150-168604172 AAGTATATCTTAATTAAGGATGG - Intronic
941848115 2:170151612-170151634 AAGTATTTATGGAGGAAGGAAGG + Intergenic
942606705 2:177699636-177699658 ATGCAGATCTGGAGGAAGAAAGG + Intronic
943778311 2:191792638-191792660 AAGTACATCTTCAGGAAAGAGGG - Intergenic
944277378 2:197854192-197854214 AAGTATTTGTTGAAGAAGGAGGG + Intronic
946260381 2:218485301-218485323 ATATATATTTAAAGGAAGGAAGG - Intronic
948123772 2:235550047-235550069 TTGTACATTTTTAGGAAGGACGG + Intronic
1169689580 20:8315591-8315613 ATGTATAAAATGAGGGAGGAAGG + Intronic
1170164450 20:13346787-13346809 ATATGTATCTTGAGGAACTAAGG - Intergenic
1171038891 20:21741692-21741714 ATGTCTATCTACAGGAAAGAAGG - Intergenic
1174772238 20:53311352-53311374 AAGTTTATATTGAGGCAGGATGG - Intronic
1176872014 21:14091613-14091635 ATATGAGTCTTGAGGAAGGAGGG - Intergenic
1178329962 21:31680106-31680128 AGGGACATCTTGAGGAAGGTGGG - Intronic
1180666655 22:17518590-17518612 ACGTCTATCTTTAGGACGGATGG + Intronic
949733313 3:7140706-7140728 CTGGATATCCTGAGGAAGTACGG + Intronic
950898394 3:16474447-16474469 TTGTTTATCTTGGGGGAGGAGGG - Intronic
951875994 3:27426361-27426383 TTTTATCTCTTGAGCAAGGAAGG - Intronic
952193687 3:31050063-31050085 GTGTACATCTTGGGGAAGGAAGG + Intergenic
953015576 3:39072707-39072729 ATGTTTTTCTAGTGGAAGGATGG + Intronic
953384813 3:42500523-42500545 ATGTATGTGTTGAGGAGTGAGGG + Intronic
954918096 3:54165497-54165519 CTCCATATATTGAGGAAGGAAGG + Intronic
955580267 3:60412268-60412290 ATAAAAATCTTGAGGAAGGTGGG + Intronic
955819923 3:62886006-62886028 ATATATTTCCTGAAGAAGGACGG + Intergenic
956512945 3:70014441-70014463 ACGTATGTCTTGAGGAATCAGGG - Intergenic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
957748657 3:84379918-84379940 ATGAATATCTTGATGCATGAAGG + Intergenic
959883799 3:111475803-111475825 CTGTATATGTAGAGGAAGAAAGG + Intronic
961028156 3:123579243-123579265 AAGTATATCTTATGGAAGGTAGG - Intronic
961627989 3:128276815-128276837 ATGAATATCTTGAGCAATGAAGG + Intronic
962020471 3:131495441-131495463 TTTTATATCTTGAAGAAAGAAGG + Intronic
962498844 3:135968467-135968489 GTGAATACCTTGAGGAAGAAAGG + Intronic
963478792 3:145840994-145841016 ATCAATATTTTGAGGAATGAAGG - Intergenic
964091939 3:152887763-152887785 ATCTACATCGTGATGAAGGAAGG - Intergenic
966709209 3:182952744-182952766 TTGTGTATGATGAGGAAGGAAGG - Intronic
972026912 4:34391866-34391888 ATTTATATCTTCATGAAGTAGGG - Intergenic
973665923 4:53159355-53159377 ATGTATATTTTGAAGAAAGATGG - Intronic
974684777 4:65213341-65213363 ATATATATTTATAGGAAGGAAGG - Intergenic
974713349 4:65632580-65632602 ATTTAAATCTTTAGGAAGAAGGG - Intronic
974938593 4:68437162-68437184 ATTTATTTCTTCAGGTAGGAAGG - Intergenic
975512775 4:75211706-75211728 ATGTAGAAATTGAGGAGGGAAGG - Intergenic
976122000 4:81793645-81793667 ATTTATATCTTGAGAAAAAACGG - Intronic
976365929 4:84232091-84232113 ATAAATATCTCGAGGAAGTAGGG - Intergenic
976675013 4:87693602-87693624 ATGAATGTCTTGAAGAAGAAGGG + Intergenic
977342650 4:95778628-95778650 GTGTATATCTTGATGCAGGTGGG - Intergenic
977451668 4:97206782-97206804 ATTAATATTTTGAGGAAGGAAGG - Intronic
978475954 4:109130102-109130124 ATGTATATTCTGTGGAAAGATGG - Intronic
979833590 4:125332066-125332088 ATCTATATTTTGAGGAAAAAGGG - Intronic
980067576 4:128206663-128206685 TTGTGTTTCTTGATGAAGGATGG + Intronic
981211121 4:142106654-142106676 ATATATATTTTGAGTAAGGATGG + Intronic
981913578 4:150009936-150009958 ATGTATGTCTTGAGGGATGTTGG - Intergenic
982708243 4:158734005-158734027 ATGTATACATTGTGGAATGATGG - Intergenic
983603328 4:169555086-169555108 ATCTATTTTTTGAGAAAGGAAGG - Intronic
984077537 4:175201887-175201909 TTGTAAATCTAGAGGAAGAAAGG - Intergenic
985056371 4:186039009-186039031 ATGTACAACTAGAGGAAGGAAGG + Intergenic
986358296 5:6950240-6950262 CCGTACATCTTGAGGAAAGAAGG + Intergenic
986811441 5:11363867-11363889 ATATATATCATTAGGAAAGAAGG + Intronic
986816743 5:11420896-11420918 TGGTATATCTTGAGGAAGTAAGG + Intronic
986944312 5:12996782-12996804 GTGTATTTCTTGAGGAGAGAAGG - Intergenic
986959367 5:13194740-13194762 ATGTGTATGTTGAGAAAAGAGGG - Intergenic
987264689 5:16240914-16240936 ATGTATATTTTGAGCTAAGAGGG - Intergenic
987811630 5:22844056-22844078 TTTTTTATCTTGATGAAGGATGG - Intronic
987995034 5:25265259-25265281 GTGTATGTGTTGGGGAAGGATGG - Intergenic
988555946 5:32236235-32236257 TTGTATATCTTGAGAAAAGGGGG - Intronic
988644552 5:33080018-33080040 ATGTATATCTTGAGTAGAGTTGG - Intergenic
991392729 5:66165738-66165760 ATGTATGTCTTGAGAGAGCAGGG + Intronic
992280291 5:75168054-75168076 ATGTATATCTTGGTGATGGGTGG - Intronic
992837085 5:80652188-80652210 GTGTATATGTTGAGTAAGGTGGG + Intronic
992936377 5:81711162-81711184 ATTCATATCTTGATGCAGGAAGG + Intronic
995176260 5:109181350-109181372 ATATAAATCTTGAGCAAAGAAGG + Intronic
996994604 5:129680184-129680206 ATGTATGTTTTTAGGAAGAAGGG - Intronic
997415948 5:133728791-133728813 ATGTATATCAGAAGGAAAGAAGG + Intergenic
998733930 5:145113134-145113156 ATGTATTTCTAGAGGAATCATGG - Intergenic
998974787 5:147633604-147633626 TAGTATAACTTGAGGAAGCATGG + Intronic
999595532 5:153199836-153199858 ATGTGTATTTGTAGGAAGGATGG + Intergenic
999648954 5:153746874-153746896 AGGTAAATCTCGAGAAAGGAGGG + Intronic
1000151124 5:158502102-158502124 ATCTATATCTTGGGGAGGGAGGG - Intergenic
1000308140 5:160015068-160015090 ATCTATAGCCTAAGGAAGGATGG + Intronic
1003926442 6:10882059-10882081 AGGTATATCTTTATAAAGGAGGG - Intronic
1004226385 6:13788319-13788341 ATGCATATCTGGAGAGAGGAGGG - Exonic
1006090928 6:31628383-31628405 TTGTATATCTGAAGGAGGGAAGG + Intronic
1006756716 6:36422663-36422685 ATGTATATCTAGAGGAGGAAGGG + Intronic
1007903152 6:45430656-45430678 ATGGAAATCTTGACAAAGGAGGG + Intronic
1009474120 6:64066436-64066458 ATTTATTTCTTGTGGAAGGAAGG - Exonic
1010693218 6:78935214-78935236 ATTTCTAAGTTGAGGAAGGAAGG - Intronic
1011851788 6:91638457-91638479 ATGGATAGCTAAAGGAAGGAAGG + Intergenic
1012383307 6:98646913-98646935 AAGGATCTCTTGAGGCAGGAAGG - Intergenic
1012396556 6:98804313-98804335 GGGTATATTTTGAAGAAGGAAGG + Intergenic
1013069661 6:106716900-106716922 ATGAATGTCTGGAGGAAGAAAGG - Intergenic
1013567965 6:111388180-111388202 ATGTATATCTAGAGAAAGATAGG - Intronic
1013795389 6:113882417-113882439 GTGTATAACATGACGAAGGATGG - Intergenic
1013946985 6:115733146-115733168 ATCTATATATTGTGGGAGGAAGG + Intergenic
1014056383 6:117019975-117019997 CATTATATCTTCAGGAAGGAGGG + Intergenic
1014721772 6:124925687-124925709 ATGTAAACCTTAAGGAATGATGG + Intergenic
1014753118 6:125274724-125274746 ATGTATTTCCTCAGGAAGGAAGG + Intronic
1016230964 6:141803683-141803705 ATATATATTTTGAAAAAGGAAGG - Intergenic
1017018481 6:150120557-150120579 ATGTATACCTAGAAGAGGGACGG + Intergenic
1017198186 6:151724335-151724357 CTGTCAGTCTTGAGGAAGGAGGG - Intronic
1021256141 7:18394651-18394673 AAGTATATCTTGAGGATCAAGGG + Intronic
1022200723 7:28114498-28114520 ATCTATATATTGAGGAAAGCAGG - Intronic
1022617033 7:31942050-31942072 ATGAATATATGGAGGAAGGGAGG + Intronic
1024730936 7:52253140-52253162 ATGAATATATTAAGGAAGCAGGG + Intergenic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1029856559 7:103523279-103523301 ATGTATAACTTAAGGAAGCATGG + Intronic
1030717774 7:112830550-112830572 ATGTATATCTTGAGGAAGGAAGG + Intronic
1031928328 7:127659621-127659643 ATGTATATCAAGAGGAATAAAGG + Intronic
1034058318 7:148059769-148059791 ATATATATATTTAGTAAGGAGGG + Intronic
1036018995 8:4820935-4820957 AAGTAAAGCTTGAGGAAAGATGG - Intronic
1036019974 8:4833689-4833711 ATCAATATCTAGTGGAAGGAGGG + Intronic
1037147600 8:15592094-15592116 ATGTAGAAGATGAGGAAGGAAGG + Intronic
1037380372 8:18278582-18278604 CTGGAGATCTTGAAGAAGGAGGG - Intergenic
1038548071 8:28441403-28441425 ATGTAATTCTTAGGGAAGGAAGG - Intronic
1041990671 8:63987026-63987048 ATTTATATCTTGAAAGAGGAAGG + Intergenic
1043072074 8:75650224-75650246 ATGTATTTCTTCATGAAGGTTGG - Intergenic
1043186260 8:77154401-77154423 ATGGGTATGTTGAGAAAGGAGGG + Intergenic
1044734321 8:95263045-95263067 ATGGTTATCTTTGGGAAGGAAGG + Intronic
1045496372 8:102712755-102712777 ATGGATATCTGAAAGAAGGAAGG + Intergenic
1046853872 8:119007021-119007043 AGGTATAACTAGAGGAAGAATGG - Intronic
1047591039 8:126328000-126328022 ATGTGTTTCATGAGGAAAGAAGG + Intergenic
1049350699 8:142163011-142163033 ATGTATAGATGGAGGATGGATGG + Intergenic
1049404307 8:142444906-142444928 GTGCAGATGTTGAGGAAGGATGG - Intergenic
1050025938 9:1334691-1334713 CTGTATATTATGAGGAAGGAAGG - Intergenic
1050172080 9:2830744-2830766 ATGTATCTTTTTAGGAATGAAGG + Intronic
1050192170 9:3038067-3038089 ATGTGTATCTTTAGAAAGGAGGG + Intergenic
1050799950 9:9598214-9598236 GTGTCCACCTTGAGGAAGGAGGG - Intronic
1051237960 9:15021886-15021908 ATGTGTATCTTCAGGAAGCTGGG + Intergenic
1052477650 9:28980970-28980992 AAGTAATTATTGAGGAAGGAGGG + Intergenic
1053522149 9:38791200-38791222 ATGTCTATCTGGGGGAAGAAAGG - Intergenic
1054194373 9:62015664-62015686 ATGTCTATCTGGGGGAAGAAAGG - Intergenic
1054644034 9:67573026-67573048 ATGTCTATCTGGGGGAAGAAAGG + Intergenic
1055504991 9:76939091-76939113 ATGTATATCATTAGGAAGAATGG + Intergenic
1055594942 9:77856383-77856405 ATATATTTCTATAGGAAGGAAGG + Intronic
1055695886 9:78883909-78883931 GAGTATATCTTGACAAAGGATGG + Intergenic
1056238994 9:84624682-84624704 CTGTGTATTTGGAGGAAGGAGGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057456080 9:95212636-95212658 ATGTGTATCTGCAGGAAGAAAGG + Intronic
1057997969 9:99837293-99837315 ATGTAAAACTTTAAGAAGGAAGG - Intronic
1059511499 9:114852305-114852327 ATGTGTATGTTGTGTAAGGAAGG + Intergenic
1059904671 9:118969417-118969439 ATGTCTAACTTGAAGAAGGCAGG - Intergenic
1062220252 9:135411174-135411196 ATGGGTGTCTTGGGGAAGGAAGG - Intergenic
1203653879 Un_KI270752v1:5016-5038 AACTATGTCTTAAGGAAGGAAGG - Intergenic
1185744351 X:2560048-2560070 ATGTATATATGGATGATGGATGG + Intergenic
1188989816 X:36803764-36803786 AGGTATAAATTCAGGAAGGAAGG - Intergenic
1189891157 X:45603873-45603895 ATGTGTATGTTGAGGGAGGTTGG + Intergenic
1189935570 X:46064955-46064977 CTAAATATCTTCAGGAAGGAGGG - Intergenic
1191087910 X:56588528-56588550 ATGTCTATGTTCAGGAAGGGTGG + Intergenic
1192453174 X:71255937-71255959 AAGTATATGTTGAGGAAGGCAGG - Intergenic
1194326137 X:92519478-92519500 ATTTTTATCTTGAGCAAAGAAGG - Intronic
1196281863 X:113831658-113831680 ATGTATATCAGGAGAAAGGTGGG - Intergenic
1196361356 X:114864419-114864441 ATGTAAATTGTGAGGAAGGAAGG - Intronic
1197469039 X:126844349-126844371 ATGTATATAATGTGGAATGATGG - Intergenic
1198089832 X:133317324-133317346 GTATATATCCTGAGGAAGGCAGG - Intronic
1199132308 X:144204958-144204980 ATGTATAAAGTGAGGAATGACGG + Intergenic
1199258122 X:145740516-145740538 TTTTATATCTTTATGAAGGAAGG + Intergenic
1200634856 Y:5638678-5638700 ATTTTTATCTTGAGCAAAGAAGG - Intronic
1201722327 Y:17113197-17113219 ATTCCTATCCTGAGGAAGGATGG - Intergenic