ID: 1030719133

View in Genome Browser
Species Human (GRCh38)
Location 7:112848625-112848647
Sequence AAGGAGAAGACTATTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030719127_1030719133 10 Left 1030719127 7:112848592-112848614 CCAGGATCAAATGGAGGGGGATG 0: 1
1: 0
2: 2
3: 7
4: 141
Right 1030719133 7:112848625-112848647 AAGGAGAAGACTATTGAGGTGGG 0: 1
1: 0
2: 3
3: 13
4: 229
1030719126_1030719133 11 Left 1030719126 7:112848591-112848613 CCCAGGATCAAATGGAGGGGGAT 0: 1
1: 0
2: 1
3: 12
4: 114
Right 1030719133 7:112848625-112848647 AAGGAGAAGACTATTGAGGTGGG 0: 1
1: 0
2: 3
3: 13
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030719133 Original CRISPR AAGGAGAAGACTATTGAGGT GGG Intronic
900864754 1:5260386-5260408 AAGGAAAAGACCTTTGATGTGGG - Intergenic
902202948 1:14847486-14847508 AAGGATTGGACTATGGAGGTGGG - Intronic
902442544 1:16440547-16440569 AAGGAGAAGCCTCTGGAGGGAGG + Intergenic
903360032 1:22771324-22771346 GAGGAGAAGACATTTGAGATGGG + Intronic
903476355 1:23621623-23621645 AAGGAGAAGACTATGCAACTGGG - Intronic
904636357 1:31884585-31884607 GAGGAGAAGCCTACTGTGGTCGG + Intergenic
904981693 1:34508813-34508835 AAAGAAAAAGCTATTGAGGTAGG + Intergenic
906137220 1:43507928-43507950 AATGGGAAGTCTGTTGAGGTTGG + Intergenic
908838473 1:68253350-68253372 AAAGAGAAGAATCATGAGGTGGG + Intergenic
909236112 1:73154035-73154057 AAGGGGAAGAATATTTAGGTAGG - Intergenic
910823763 1:91382907-91382929 AATGACAAGACTACTGTGGTAGG + Intronic
911232577 1:95376694-95376716 TAGGAAAAGACTATTAAGTTTGG + Intergenic
913645313 1:120849311-120849333 AAAGAGAAAACTACTGAGGAAGG - Intergenic
914081416 1:144414228-144414250 AAAGAGAAAACTACTGAGGAAGG + Intergenic
914176325 1:145282767-145282789 AAAGAGAAAACTACTGAGGAAGG + Intergenic
914531052 1:148524253-148524275 AAAGAGAAAACTACTGAGGAAGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
917380251 1:174398401-174398423 AAGAAGAAGACTCATGACGTAGG - Intronic
919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG + Intronic
920984582 1:210874053-210874075 AAAGAAAAGTCTACTGAGGTTGG + Intronic
922925858 1:229346156-229346178 AAGAAGAAAATTATTGAGATAGG + Intergenic
922974318 1:229771020-229771042 TAGGAGAAAACAATTGAGGGAGG + Intergenic
923336545 1:232975927-232975949 AAGGCAAAGACTCCTGAGGTTGG + Intronic
924099976 1:240593198-240593220 AAGGAGATGACATTTGAGATGGG - Intronic
1071352922 10:84764519-84764541 ATGGAGAAGAATATTGGGTTAGG + Intergenic
1071853767 10:89602434-89602456 ATGGTGAAGACTTTTGAGGGAGG - Intronic
1072425403 10:95325854-95325876 AAGGACAAGAGTATAGAAGTGGG - Intronic
1073244335 10:102078842-102078864 AAGGACAAGACCATTCAGCTGGG - Intergenic
1073557206 10:104464829-104464851 AGGGTGAAGACTATTATGGTGGG + Intergenic
1074661606 10:115665167-115665189 AAGGTAAAGACTACTGATGTAGG + Intronic
1075535458 10:123268472-123268494 AAGCACAAGACTATTGATTTCGG - Intergenic
1075826588 10:125362057-125362079 AAGAAGATGACCCTTGAGGTGGG + Intergenic
1075978955 10:126720864-126720886 GAGGAGAAGACTATGGAGGTTGG + Intergenic
1076219424 10:128721312-128721334 AAGGTCAAGTCTAATGAGGTGGG - Intergenic
1077730919 11:4728683-4728705 AAGGGGAAGACTATTAAGAGGGG - Intronic
1078001918 11:7503704-7503726 GAGGAAGAGACTACTGAGGTAGG + Intronic
1080620037 11:33979643-33979665 AAAGAGAAGAGTTTTGAGGATGG - Intergenic
1085234654 11:75005124-75005146 AAGGAGGTGACTTTTGAGTTGGG + Intronic
1086319708 11:85632101-85632123 TAGGAGAAAACCATTGAGGGGGG + Intronic
1087235487 11:95713507-95713529 AATGAGAATACAATTCAGGTTGG - Intergenic
1089003477 11:115071172-115071194 ATGGTAAAGACTATTGAGTTAGG - Intergenic
1089590588 11:119537937-119537959 GAGGAGGAGTCTATTGAAGTGGG + Intergenic
1089668708 11:120037057-120037079 AATGTGAATACTTTTGAGGTGGG - Intergenic
1093885003 12:24449315-24449337 AGAGAGAAGACTAATGTGGTTGG - Intergenic
1095125202 12:38469062-38469084 AAGGAGAAGACTTTTCAGACTGG - Intergenic
1095131148 12:38544067-38544089 ATGAAGGAGACTATTTAGGTTGG - Intergenic
1095467853 12:42506550-42506572 AAAAAGAACACTATTGAGCTGGG - Intronic
1096879842 12:54658618-54658640 AAGCAGAAGAGTGTTGGGGTTGG - Intergenic
1097204154 12:57306063-57306085 CAGGATAAGAATATTAAGGTGGG + Intronic
1097472450 12:60011253-60011275 ATGGAGAAGAATATTGGGTTAGG + Intergenic
1098058831 12:66538546-66538568 AAGCAGAAGAGTAGTGAGATTGG + Intronic
1100359427 12:93862429-93862451 AAGGAGATGAATCTTGAGCTGGG + Intronic
1100363392 12:93898102-93898124 AGGGAGAAGACTATGTAGGCTGG + Intergenic
1101450232 12:104769619-104769641 AAAGGGAAGACTATAGACGTGGG - Intergenic
1102491525 12:113292256-113292278 AAGGAGAAGCCTCTGGAGGACGG - Intronic
1103151879 12:118647965-118647987 AAGGAGAAGATAATAGATGTTGG + Intergenic
1104606124 12:130189696-130189718 AAAGAGAAGAGTAATGAGGAGGG - Intergenic
1106380330 13:29230854-29230876 ATGCAGAAGAGTATTTAGGTGGG + Intronic
1107777473 13:43861548-43861570 AAGAAGAGGACTATGGAGGATGG - Intronic
1107906840 13:45069182-45069204 AAGGAGAAGGCTTTGGAGGACGG - Intergenic
1108250282 13:48560149-48560171 AAGGAACAAACTATTGACGTAGG + Intergenic
1108980413 13:56504462-56504484 AATGAGAAGACTGATAAGGTAGG - Intergenic
1112095377 13:96126862-96126884 AAGGAGAAGACTAAAGAGAGAGG - Intronic
1114810193 14:25890029-25890051 ACAGAGAAGATTATTGATGTCGG - Intergenic
1117112243 14:52470110-52470132 AAGCAGAAGAATATTTAAGTGGG - Exonic
1118905755 14:70022047-70022069 AAGGAGAAAAAGATTGATGTTGG - Intronic
1120289771 14:82552941-82552963 AAAAAGGAGGCTATTGAGGTGGG + Intergenic
1120635143 14:86941778-86941800 AAGAAGAAGACTACAGAAGTTGG - Intergenic
1121029741 14:90647853-90647875 ATGGAGCAGACTAATTAGGTGGG + Intronic
1121354838 14:93205918-93205940 AAGGATAAGACTTTTGAGCTGGG - Intronic
1124054764 15:26232044-26232066 AAGAACAAGACTATTAAGTTGGG + Intergenic
1124477084 15:30044711-30044733 AAGGCGAAGACTGTGGAGGGCGG - Intergenic
1124695217 15:31858540-31858562 AAGGAAAACACTATTAAGGAGGG + Intronic
1124750531 15:32368685-32368707 AAGGAGAAAACAAATGAGGGGGG - Intergenic
1125376948 15:39040239-39040261 AAGGAGAAGACTAGTGTGAGAGG - Intergenic
1125686602 15:41567329-41567351 AAGCAGAAAACTAATGATGTAGG - Intronic
1125837974 15:42770776-42770798 AAGGTGAAGACTCTTTGGGTTGG - Intronic
1126267104 15:46767839-46767861 AAGCAGAAAACTTTTGTGGTTGG + Intergenic
1126461511 15:48919724-48919746 AAGGAGAGGACATTTGAGCTAGG - Intronic
1127127360 15:55824855-55824877 AAAAGGAAGACTATTCAGGTGGG + Intergenic
1132302195 15:100782877-100782899 AAGGTTATGACTATTCAGGTTGG + Intergenic
1133092590 16:3415901-3415923 ATGGAGTAGACTGTTCAGGTTGG - Intronic
1133920765 16:10151017-10151039 GAGGAGATGACTGTTGAGCTGGG + Intronic
1134365871 16:13578763-13578785 AAGGGGAAGACTTTTGAGGAGGG - Intergenic
1135105671 16:19646880-19646902 AAGGTGAAGACTGTTCAGGCTGG - Intronic
1135875518 16:26196480-26196502 AAGCAGAAGCCTCATGAGGTTGG - Intergenic
1139113591 16:63922027-63922049 AAGGATGAGACTATTAAGTTAGG + Intergenic
1141341830 16:83210616-83210638 AAGGAGCAGAGGATAGAGGTTGG + Intronic
1141379644 16:83564792-83564814 AGAGAGAAGAGTATGGAGGTTGG + Intronic
1144401933 17:14913012-14913034 AAAGAGAAGGCTAGTGAGGGAGG + Intergenic
1145861731 17:28216891-28216913 AAGGAAAAGACTTGTGAGGTAGG + Intergenic
1146089441 17:29861550-29861572 AAGAAGAAGATTATGGTGGTGGG - Intronic
1146436283 17:32851560-32851582 ATGGAGGAGACCATTGAGTTTGG - Intronic
1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG + Intronic
1147871417 17:43590255-43590277 ACGGAGAAGACTCTTGGGGCTGG - Intergenic
1149110662 17:53025467-53025489 AAAGAGATGGCTATTGTGGTAGG + Intergenic
1149352812 17:55809032-55809054 TTGGAGAAGACTACTGATGTAGG - Intronic
1149638075 17:58186099-58186121 AAGGACCAGACTGTGGAGGTGGG + Intergenic
1157046634 18:44107881-44107903 AAGTAGACCACTTTTGAGGTAGG - Intergenic
1157258576 18:46159440-46159462 AATAAGAAGACAATTGAGCTGGG - Intergenic
1159085341 18:63783527-63783549 AATGTGAGGACTATTCAGGTAGG - Intronic
1159140470 18:64388453-64388475 AAGGAGGAGAATTTTGATGTAGG - Intergenic
1159374161 18:67570400-67570422 ATGAAGAAGATTAATGAGGTTGG + Intergenic
1159386355 18:67730215-67730237 AAAGAGAAGAAAATTGTGGTGGG + Intergenic
1159514594 18:69441958-69441980 AAGGAGATGACATTTAAGGTGGG + Intronic
1159850340 18:73519906-73519928 AAGCAGATGACAAATGAGGTAGG - Intergenic
1161764956 19:6202275-6202297 AAGGAGTAAACTGTTGAGGTGGG + Intergenic
1161842945 19:6693700-6693722 GAGGAGAAGGATATTGAGGGTGG + Intronic
1163375127 19:16925381-16925403 AAGGAGAAGAGAGTTGAGTTGGG + Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165763277 19:38335221-38335243 AAGGAGTAGAATTTTGGGGTAGG + Intergenic
1167204779 19:48093655-48093677 AATGAGAAGACCAGTGAGGCTGG - Intronic
1168539490 19:57198474-57198496 AGGGTGAAGGCTATTAAGGTGGG - Intronic
924995475 2:356672-356694 AAGGAAAAGACAATTGAATTAGG + Intergenic
926829883 2:16950175-16950197 AAGTGAAAAACTATTGAGGTAGG - Intergenic
930203775 2:48568465-48568487 CAGAAGTAGACTCTTGAGGTTGG + Intronic
933727495 2:85435038-85435060 AAGAAGCAGATTATTGAGCTGGG - Exonic
933744668 2:85561768-85561790 ACGGAGAGGACTAATGGGGTCGG - Intronic
933982062 2:87558678-87558700 AAGGAGAAGAGTATGGAAGGAGG - Intergenic
935483875 2:103628712-103628734 AATGAGAAAATTATTGAAGTGGG + Intergenic
939419501 2:141947557-141947579 AAGAAAAAGACTATTTAGGAGGG + Intronic
940791656 2:158035454-158035476 AAGGATCAGAATATTGAAGTGGG + Intronic
941094023 2:161214916-161214938 AAGGAGAGGCATATTGAGCTTGG + Intronic
941148262 2:161881056-161881078 AAAGACAAGACTATTTAGTTAGG + Intronic
942385309 2:175436578-175436600 AAGCAGAAGCCTATTGATATTGG + Intergenic
944393858 2:199247549-199247571 AAGGAGAAAGTGATTGAGGTTGG - Intergenic
944670659 2:201991853-201991875 AAGGAGCAGAATATTGTAGTGGG - Intergenic
945506884 2:210652616-210652638 AAGGAGAAAAGTATAGAGGGAGG + Intronic
945996239 2:216438736-216438758 AAGGTCAAGACTGTTGAGGCTGG + Intronic
946464336 2:219897949-219897971 CAGTAGAAGACTCCTGAGGTTGG - Intergenic
948036977 2:234865656-234865678 TAGGAGAAGAGTAATGTGGTTGG - Intergenic
948959010 2:241316846-241316868 AAGGAGAAGGCAGTTAAGGTGGG - Intronic
1169689991 20:8319832-8319854 AAGGAGAAGCCTCTTGGGGTGGG + Intronic
1172091629 20:32436817-32436839 AATGAGAAGACTTTTGTGGGGGG + Exonic
1172788730 20:37487682-37487704 AAGGGGAAGACAAGTGAGGGTGG - Intergenic
1173052237 20:39574651-39574673 TAGGAGAAGGCTATTGAGAAGGG - Intergenic
1177512672 21:22110325-22110347 AAAGAGAAAACAATTGAGCTGGG + Intergenic
1177972718 21:27810106-27810128 CAGGAGGAGACAATTCAGGTGGG + Intergenic
1182927520 22:34139538-34139560 AGGGAGAAAACTATTCAGGGAGG - Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949887523 3:8708427-8708449 AAAGAAAAGCCTATAGAGGTTGG + Intronic
950110935 3:10418316-10418338 AAAGAAAAGGCTATTGAGGTAGG + Intronic
952110201 3:30114135-30114157 AAGGAGAATAATATGGAGCTTGG - Intergenic
953520189 3:43635024-43635046 AAGGAGAAGTCCATGGAGCTGGG + Intronic
954023345 3:47761786-47761808 TAGGAGAAAACTATTGAATTTGG - Intronic
957497689 3:81011427-81011449 AAGGTGCAGCCTACTGAGGTAGG - Intergenic
960247166 3:115412588-115412610 AAGGAGATGACATTTGAGTTGGG - Intergenic
960353235 3:116618753-116618775 AAGGAAATGCCTATGGAGGTTGG - Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960626755 3:119688647-119688669 ATGAAGAAGACTATTTAGATTGG - Intergenic
964510407 3:157444113-157444135 CAGGAGAATACTAGTGTGGTGGG - Intronic
967240847 3:187438134-187438156 AAGGAGAAGACTGTGAAAGTAGG + Intergenic
967741805 3:193011105-193011127 AGGGATAAGAATATTGAAGTTGG - Intergenic
968725323 4:2245224-2245246 AAGTAGAAGACTATAGGGTTGGG + Intergenic
970107617 4:12602808-12602830 AAGTAGAACTCAATTGAGGTGGG - Intergenic
971562780 4:28102514-28102536 AAGAAGAAAAATATTGAGGGTGG + Intergenic
975362899 4:73492541-73492563 AAGGGGAAGACTAGTGAACTTGG + Intronic
977201929 4:94126760-94126782 AGGGAAAAGACAATTGAGTTGGG + Intergenic
977208401 4:94190163-94190185 AAGGAGATGGCTATTCAGTTGGG - Intergenic
977650463 4:99462766-99462788 AAATGGAAGACTATTGAGGTAGG + Intergenic
978793385 4:112685391-112685413 AAGAAGAAATCTATTGAGTTTGG - Intergenic
980793526 4:137651092-137651114 AAGAAGAAGCCTGTGGAGGTCGG + Intergenic
981535912 4:145799602-145799624 AAGGAGAAAAGTATGGATGTTGG - Intronic
981659072 4:147145300-147145322 GAGGAGAAGGCCATTGAAGTTGG + Intergenic
981934189 4:150221289-150221311 AAGGAGAAGAGGATGGTGGTGGG - Intronic
987442158 5:17968967-17968989 GAGAAGAAGACTAATGAGGAGGG - Intergenic
990635050 5:57715982-57716004 AAGTAGAAGACTAATGTGATTGG - Intergenic
993182205 5:84567979-84568001 AAGGAGAACAGTATTGATTTAGG + Intergenic
993395890 5:87388017-87388039 AAGGAGATAATAATTGAGGTGGG - Intronic
993864542 5:93176503-93176525 AAGGGGAAAACTGTTGAGGCAGG - Intergenic
994272359 5:97794250-97794272 AAGCAGATGATTATTGACGTAGG + Intergenic
995001666 5:107138838-107138860 AAGAAGAAGATTATTTAGTTGGG - Intergenic
995118340 5:108507293-108507315 AAGGAGAAGAATCTTGAGATGGG - Intergenic
996890115 5:128408814-128408836 AAGGAGAAGATGATTGAGAAAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997363053 5:133307284-133307306 GAGGAGAAGACCATTGAGTTGGG + Intronic
998194848 5:140059696-140059718 AAGGAGATGACTGTTGAATTTGG - Intergenic
998266043 5:140668614-140668636 CAGCAGAAGACTATTGATGGGGG - Exonic
998882229 5:146655841-146655863 AAGGAGAAGACTACCAAGCTAGG + Intronic
999094524 5:148966135-148966157 AAGCAGAAGACTAGTGAGGCAGG - Intronic
999644139 5:153701274-153701296 AAGGAGGAGGCTACTGAGGCAGG - Intronic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1000484358 5:161821610-161821632 ATGGAGAAGACTATGGGGATCGG - Intergenic
1000495119 5:161972734-161972756 AAGGAGAAGAGTAGTGTGATAGG + Intergenic
1001001918 5:168015574-168015596 AAGGAGAAGTCTGTTTAGTTTGG + Intronic
1001779043 5:174351703-174351725 AAGGAGAAGCTTTTTGAGCTAGG - Intergenic
1003011224 6:2429098-2429120 AAGGAAAAGACCAGTGAAGTGGG + Intergenic
1004294458 6:14397563-14397585 GAGGAGAAGGCAATTGAGGAAGG - Intergenic
1004460549 6:15831719-15831741 AAGGTGAAGACTATAGAGCTAGG - Intergenic
1005213231 6:23494010-23494032 AAGGAGTTGACTTTGGAGGTAGG - Intergenic
1007308495 6:40925988-40926010 AAGGAGAAGAGCATTCTGGTGGG - Intergenic
1010012629 6:71067248-71067270 AATTAGAAGAGTATGGAGGTGGG + Intergenic
1010824486 6:80455848-80455870 AAAAAGAAGACCATTGACGTTGG + Intergenic
1013313253 6:108917395-108917417 AAGGAAAGGACTGATGAGGTGGG - Intronic
1014045354 6:116877693-116877715 AAGGAGTAGCCTACTGGGGTGGG - Intronic
1015064650 6:129009590-129009612 AAGGAAAAGACTATGAATGTAGG + Intronic
1015333395 6:132007047-132007069 AAGGAGTGGACTAATGAGGACGG - Intergenic
1016411738 6:143790418-143790440 AAGGAGCAGACCCTTGAGGACGG + Intronic
1016720055 6:147286169-147286191 AAGGAAAGGATTGTTGAGGTGGG - Intronic
1021484287 7:21149771-21149793 GTGGAGAAGGCTATGGAGGTGGG - Intergenic
1022313119 7:29216253-29216275 AAGGAAAAGACAATTAGGGTTGG + Intronic
1026486506 7:70826160-70826182 AAGGAGCAGACCATTTAGTTAGG - Intergenic
1026839560 7:73662182-73662204 AAGAAGAAGAATCTTGAGATGGG - Intergenic
1027694327 7:81390063-81390085 AAAAAGAAAACTTTTGAGGTGGG + Intergenic
1028737963 7:94239405-94239427 AAGTGTAAGACTCTTGAGGTTGG - Intergenic
1030223994 7:107128458-107128480 CAGGAGAGGAATATTGAGTTTGG + Intronic
1030719133 7:112848625-112848647 AAGGAGAAGACTATTGAGGTGGG + Intronic
1033131501 7:138749349-138749371 AAGGAGAAGAGTCTTGGGCTGGG + Intronic
1034922569 7:155096008-155096030 GAGGAGAGGATTATTGAGCTTGG - Intergenic
1035079834 7:156206739-156206761 CAGGAGAAGAATTTAGAGGTGGG - Intergenic
1036801905 8:11798957-11798979 AAGGAAAAGGCGTTTGAGGTAGG + Intronic
1037547272 8:19936696-19936718 AAGGGGAATATTATTGAGTTTGG + Intronic
1038773738 8:30509203-30509225 AAGGAGAAGAATATGAAAGTAGG - Intronic
1039344691 8:36690837-36690859 AAAGAGAAGACTATTAAGCCGGG + Intergenic
1041741129 8:61158134-61158156 AAGGAACAAACTATTGATGTAGG + Intronic
1042694194 8:71538720-71538742 GAGTAGAAGACTATCCAGGTAGG + Intronic
1042835493 8:73076093-73076115 TAGCAAAACACTATTGAGGTGGG + Intronic
1043755320 8:83996326-83996348 AAGGAGAAGACAATTCAGCCCGG + Intergenic
1044831576 8:96255167-96255189 GAGGAGAAGACTATCAAGATAGG + Intronic
1045204194 8:100020178-100020200 AAGGAGAAGAAAATTGCGGCCGG - Intronic
1047120885 8:121903303-121903325 AAGCAGAAGATCATTGAGGATGG + Intergenic
1048324987 8:133432081-133432103 AATGAGCAGACACTTGAGGTGGG - Intergenic
1050264669 9:3877789-3877811 AAGGAGAAGAATATTGCAGGAGG - Intronic
1050453792 9:5812470-5812492 AAGGATAGGAATATTGAGTTTGG + Intronic
1050791128 9:9471463-9471485 AATGAGAAGAGTATTGATTTTGG - Intronic
1051466389 9:17382859-17382881 AAAGATAAGGCTAATGAGGTAGG - Intronic
1055399738 9:75910168-75910190 AAGGAGAAAACTATTGAGCTTGG - Intronic
1055465458 9:76561095-76561117 ACGGGGAAGACTTTTGAGGGTGG - Intergenic
1056208287 9:84340864-84340886 AAGGAAAAGATTAATAAGGTGGG - Intergenic
1056416953 9:86386155-86386177 AAGAAGAAGACTTTTGAGTTAGG - Intergenic
1057637941 9:96788172-96788194 CAGGAGAAGACTATTGAGATAGG - Intergenic
1060733750 9:126053414-126053436 AAGGAGAAGGAAATTGAGATGGG - Intergenic
1061022575 9:128025829-128025851 TAGGAGAAGGCTCTGGAGGTCGG - Intergenic
1061179683 9:129017244-129017266 CAAGAGTAGACTATTGAGGCTGG - Intronic
1203631791 Un_KI270750v1:77717-77739 AAGGACAAGAATATACAGGTAGG - Intergenic
1186019410 X:5237274-5237296 TTGGAGAAGAGTTTTGAGGTTGG + Intergenic
1187558226 X:20373644-20373666 AAGGAAAAGAAAATAGAGGTGGG - Intergenic
1191731278 X:64338375-64338397 AAGGAGGAGACAACTAAGGTGGG + Intronic
1191761491 X:64652458-64652480 AAGGAGAAGAAATTTGAGCTTGG - Intergenic
1191897070 X:66003890-66003912 GAGGAGATGACAATTGAGCTGGG + Intergenic
1192216106 X:69159499-69159521 AATGAGAAGACTCATGGGGTTGG - Intergenic
1193213423 X:78835318-78835340 TAGGAGAAGAATCTTGGGGTTGG - Intergenic
1194573674 X:95584627-95584649 AAGGAGAAGAAAATATAGGTGGG + Intergenic
1197302224 X:124794968-124794990 TAGGAGGTGACAATTGAGGTGGG - Intronic
1199764874 X:150934271-150934293 CGAGAGAAGACTCTTGAGGTGGG + Intergenic
1200934231 Y:8724277-8724299 AAGAAGAACACCATGGAGGTGGG - Intergenic