ID: 1030732934

View in Genome Browser
Species Human (GRCh38)
Location 7:113011256-113011278
Sequence CAGAGCAACTACTTTAGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030732934_1030732936 -1 Left 1030732934 7:113011256-113011278 CCTAATCTAAAGTAGTTGCTCTG No data
Right 1030732936 7:113011278-113011300 GAAAGGTTCAGACAAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030732934 Original CRISPR CAGAGCAACTACTTTAGATT AGG (reversed) Intergenic
No off target data available for this crispr