ID: 1030733556

View in Genome Browser
Species Human (GRCh38)
Location 7:113017724-113017746
Sequence GTGCGGGGGCACGGTGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030733534_1030733556 26 Left 1030733534 7:113017675-113017697 CCCCCTGCTCCATGGCGCCCAGT No data
Right 1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG No data
1030733551_1030733556 -9 Left 1030733551 7:113017710-113017732 CCAAGGGCTGAGGAGTGCGGGGG No data
Right 1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG No data
1030733544_1030733556 2 Left 1030733544 7:113017699-113017721 CCATCGACCACCCAAGGGCTGAG No data
Right 1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG No data
1030733533_1030733556 29 Left 1030733533 7:113017672-113017694 CCACCCCCTGCTCCATGGCGCCC No data
Right 1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG No data
1030733537_1030733556 23 Left 1030733537 7:113017678-113017700 CCTGCTCCATGGCGCCCAGTCCC No data
Right 1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG No data
1030733538_1030733556 17 Left 1030733538 7:113017684-113017706 CCATGGCGCCCAGTCCCATCGAC No data
Right 1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG No data
1030733536_1030733556 24 Left 1030733536 7:113017677-113017699 CCCTGCTCCATGGCGCCCAGTCC No data
Right 1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG No data
1030733539_1030733556 9 Left 1030733539 7:113017692-113017714 CCCAGTCCCATCGACCACCCAAG No data
Right 1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG No data
1030733540_1030733556 8 Left 1030733540 7:113017693-113017715 CCAGTCCCATCGACCACCCAAGG No data
Right 1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG No data
1030733549_1030733556 -8 Left 1030733549 7:113017709-113017731 CCCAAGGGCTGAGGAGTGCGGGG No data
Right 1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG No data
1030733546_1030733556 -5 Left 1030733546 7:113017706-113017728 CCACCCAAGGGCTGAGGAGTGCG No data
Right 1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG No data
1030733535_1030733556 25 Left 1030733535 7:113017676-113017698 CCCCTGCTCCATGGCGCCCAGTC No data
Right 1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG No data
1030733543_1030733556 3 Left 1030733543 7:113017698-113017720 CCCATCGACCACCCAAGGGCTGA No data
Right 1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030733556 Original CRISPR GTGCGGGGGCACGGTGGCGC GGG Intergenic