ID: 1030735842

View in Genome Browser
Species Human (GRCh38)
Location 7:113047669-113047691
Sequence CTATCTATGGTGATGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030735842_1030735847 -3 Left 1030735842 7:113047669-113047691 CCCACCATCATCACCATAGATAG No data
Right 1030735847 7:113047689-113047711 TAGGTGTGCTTGAATTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030735842 Original CRISPR CTATCTATGGTGATGATGGT GGG (reversed) Intergenic
No off target data available for this crispr