ID: 1030740127

View in Genome Browser
Species Human (GRCh38)
Location 7:113099636-113099658
Sequence TATGAGGAGTGGGAATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030740127_1030740131 3 Left 1030740127 7:113099636-113099658 CCTGGAAATTCCCACTCCTCATA No data
Right 1030740131 7:113099662-113099684 TCCCTCTGTTTAAACACAGATGG No data
1030740127_1030740134 10 Left 1030740127 7:113099636-113099658 CCTGGAAATTCCCACTCCTCATA No data
Right 1030740134 7:113099669-113099691 GTTTAAACACAGATGGACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030740127 Original CRISPR TATGAGGAGTGGGAATTTCC AGG (reversed) Intergenic
No off target data available for this crispr