ID: 1030740129

View in Genome Browser
Species Human (GRCh38)
Location 7:113099647-113099669
Sequence CAGAGGGAAGATATGAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030740129_1030740131 -8 Left 1030740129 7:113099647-113099669 CCACTCCTCATATCTTCCCTCTG No data
Right 1030740131 7:113099662-113099684 TCCCTCTGTTTAAACACAGATGG No data
1030740129_1030740134 -1 Left 1030740129 7:113099647-113099669 CCACTCCTCATATCTTCCCTCTG No data
Right 1030740134 7:113099669-113099691 GTTTAAACACAGATGGACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030740129 Original CRISPR CAGAGGGAAGATATGAGGAG TGG (reversed) Intergenic
No off target data available for this crispr