ID: 1030740130

View in Genome Browser
Species Human (GRCh38)
Location 7:113099652-113099674
Sequence TTAAACAGAGGGAAGATATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030740130_1030740134 -6 Left 1030740130 7:113099652-113099674 CCTCATATCTTCCCTCTGTTTAA No data
Right 1030740134 7:113099669-113099691 GTTTAAACACAGATGGACTATGG No data
1030740130_1030740135 26 Left 1030740130 7:113099652-113099674 CCTCATATCTTCCCTCTGTTTAA No data
Right 1030740135 7:113099701-113099723 TATCAGAATGTGATTCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030740130 Original CRISPR TTAAACAGAGGGAAGATATG AGG (reversed) Intergenic
No off target data available for this crispr