ID: 1030740134

View in Genome Browser
Species Human (GRCh38)
Location 7:113099669-113099691
Sequence GTTTAAACACAGATGGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030740127_1030740134 10 Left 1030740127 7:113099636-113099658 CCTGGAAATTCCCACTCCTCATA No data
Right 1030740134 7:113099669-113099691 GTTTAAACACAGATGGACTATGG No data
1030740128_1030740134 0 Left 1030740128 7:113099646-113099668 CCCACTCCTCATATCTTCCCTCT No data
Right 1030740134 7:113099669-113099691 GTTTAAACACAGATGGACTATGG No data
1030740129_1030740134 -1 Left 1030740129 7:113099647-113099669 CCACTCCTCATATCTTCCCTCTG No data
Right 1030740134 7:113099669-113099691 GTTTAAACACAGATGGACTATGG No data
1030740130_1030740134 -6 Left 1030740130 7:113099652-113099674 CCTCATATCTTCCCTCTGTTTAA No data
Right 1030740134 7:113099669-113099691 GTTTAAACACAGATGGACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030740134 Original CRISPR GTTTAAACACAGATGGACTA TGG Intergenic
No off target data available for this crispr