ID: 1030742236

View in Genome Browser
Species Human (GRCh38)
Location 7:113123850-113123872
Sequence ATACGTACGGTATTCTATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030742236_1030742244 29 Left 1030742236 7:113123850-113123872 CCTTAATAGAATACCGTACGTAT No data
Right 1030742244 7:113123902-113123924 ACACAGACAGTAGAGGATCCAGG No data
1030742236_1030742245 30 Left 1030742236 7:113123850-113123872 CCTTAATAGAATACCGTACGTAT No data
Right 1030742245 7:113123903-113123925 CACAGACAGTAGAGGATCCAGGG No data
1030742236_1030742240 2 Left 1030742236 7:113123850-113123872 CCTTAATAGAATACCGTACGTAT No data
Right 1030742240 7:113123875-113123897 TTGGTGACCAGACATTAAAAGGG No data
1030742236_1030742239 1 Left 1030742236 7:113123850-113123872 CCTTAATAGAATACCGTACGTAT No data
Right 1030742239 7:113123874-113123896 TTTGGTGACCAGACATTAAAAGG No data
1030742236_1030742242 22 Left 1030742236 7:113123850-113123872 CCTTAATAGAATACCGTACGTAT No data
Right 1030742242 7:113123895-113123917 GGGACCTACACAGACAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030742236 Original CRISPR ATACGTACGGTATTCTATTA AGG (reversed) Intergenic
No off target data available for this crispr