ID: 1030742238

View in Genome Browser
Species Human (GRCh38)
Location 7:113123863-113123885
Sequence CTGGTCACCAAAGATACGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030742238_1030742245 17 Left 1030742238 7:113123863-113123885 CCGTACGTATCTTTGGTGACCAG No data
Right 1030742245 7:113123903-113123925 CACAGACAGTAGAGGATCCAGGG No data
1030742238_1030742244 16 Left 1030742238 7:113123863-113123885 CCGTACGTATCTTTGGTGACCAG No data
Right 1030742244 7:113123902-113123924 ACACAGACAGTAGAGGATCCAGG No data
1030742238_1030742242 9 Left 1030742238 7:113123863-113123885 CCGTACGTATCTTTGGTGACCAG No data
Right 1030742242 7:113123895-113123917 GGGACCTACACAGACAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030742238 Original CRISPR CTGGTCACCAAAGATACGTA CGG (reversed) Intergenic
No off target data available for this crispr