ID: 1030742245

View in Genome Browser
Species Human (GRCh38)
Location 7:113123903-113123925
Sequence CACAGACAGTAGAGGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030742236_1030742245 30 Left 1030742236 7:113123850-113123872 CCTTAATAGAATACCGTACGTAT No data
Right 1030742245 7:113123903-113123925 CACAGACAGTAGAGGATCCAGGG No data
1030742238_1030742245 17 Left 1030742238 7:113123863-113123885 CCGTACGTATCTTTGGTGACCAG No data
Right 1030742245 7:113123903-113123925 CACAGACAGTAGAGGATCCAGGG No data
1030742241_1030742245 -2 Left 1030742241 7:113123882-113123904 CCAGACATTAAAAGGGACCTACA No data
Right 1030742245 7:113123903-113123925 CACAGACAGTAGAGGATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030742245 Original CRISPR CACAGACAGTAGAGGATCCA GGG Intergenic
No off target data available for this crispr