ID: 1030745886

View in Genome Browser
Species Human (GRCh38)
Location 7:113166002-113166024
Sequence GAGACCTAAAGAGTAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030745882_1030745886 4 Left 1030745882 7:113165975-113165997 CCTCTTTGAGGAGGTCATAGCGG No data
Right 1030745886 7:113166002-113166024 GAGACCTAAAGAGTAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030745886 Original CRISPR GAGACCTAAAGAGTAACCCA GGG Intergenic
No off target data available for this crispr