ID: 1030748164

View in Genome Browser
Species Human (GRCh38)
Location 7:113194335-113194357
Sequence GTGTTCTTGTAGTAGTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030748160_1030748164 3 Left 1030748160 7:113194309-113194331 CCAATGTCCTGAAGATTTTTCCC 0: 3
1: 41
2: 321
3: 1231
4: 3268
Right 1030748164 7:113194335-113194357 GTGTTCTTGTAGTAGTTTCATGG No data
1030748158_1030748164 9 Left 1030748158 7:113194303-113194325 CCCAGGCCAATGTCCTGAAGATT 0: 3
1: 36
2: 384
3: 1525
4: 3835
Right 1030748164 7:113194335-113194357 GTGTTCTTGTAGTAGTTTCATGG No data
1030748161_1030748164 -4 Left 1030748161 7:113194316-113194338 CCTGAAGATTTTTCCCAATGTGT No data
Right 1030748164 7:113194335-113194357 GTGTTCTTGTAGTAGTTTCATGG No data
1030748159_1030748164 8 Left 1030748159 7:113194304-113194326 CCAGGCCAATGTCCTGAAGATTT 0: 3
1: 22
2: 195
3: 783
4: 1710
Right 1030748164 7:113194335-113194357 GTGTTCTTGTAGTAGTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030748164 Original CRISPR GTGTTCTTGTAGTAGTTTCA TGG Intergenic
No off target data available for this crispr