ID: 1030750967

View in Genome Browser
Species Human (GRCh38)
Location 7:113232315-113232337
Sequence CTGTTTCCACATATGTAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030750967_1030750971 25 Left 1030750967 7:113232315-113232337 CCATATTACATATGTGGAAACAG No data
Right 1030750971 7:113232363-113232385 CAACATCACAAGCTAGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030750967 Original CRISPR CTGTTTCCACATATGTAATA TGG (reversed) Intergenic
No off target data available for this crispr