ID: 1030754514

View in Genome Browser
Species Human (GRCh38)
Location 7:113271819-113271841
Sequence TCTTGTAGGCAGCAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030754514_1030754518 0 Left 1030754514 7:113271819-113271841 CCATCCACCTGCTGCCTACAAGA No data
Right 1030754518 7:113271842-113271864 CACACATCTAGCTTTAATATAGG No data
1030754514_1030754521 24 Left 1030754514 7:113271819-113271841 CCATCCACCTGCTGCCTACAAGA No data
Right 1030754521 7:113271866-113271888 ACAGACTCAAAGTAAATGGGTGG No data
1030754514_1030754519 20 Left 1030754514 7:113271819-113271841 CCATCCACCTGCTGCCTACAAGA No data
Right 1030754519 7:113271862-113271884 AGGTACAGACTCAAAGTAAATGG No data
1030754514_1030754520 21 Left 1030754514 7:113271819-113271841 CCATCCACCTGCTGCCTACAAGA No data
Right 1030754520 7:113271863-113271885 GGTACAGACTCAAAGTAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030754514 Original CRISPR TCTTGTAGGCAGCAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr