ID: 1030755070

View in Genome Browser
Species Human (GRCh38)
Location 7:113277542-113277564
Sequence GGTGGTCTGTGATCATTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030755070_1030755075 25 Left 1030755070 7:113277542-113277564 CCTTTAAATGATCACAGACCACC No data
Right 1030755075 7:113277590-113277612 TCCACCACATGCATGACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030755070 Original CRISPR GGTGGTCTGTGATCATTTAA AGG (reversed) Intergenic
No off target data available for this crispr