ID: 1030757186

View in Genome Browser
Species Human (GRCh38)
Location 7:113301320-113301342
Sequence AGGGTTGAACAGATGAAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030757186_1030757189 -1 Left 1030757186 7:113301320-113301342 CCGTGCTTCATCTGTTCAACCCT No data
Right 1030757189 7:113301342-113301364 TGCCCCTCCCTCTGCATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030757186 Original CRISPR AGGGTTGAACAGATGAAGCA CGG (reversed) Intergenic
No off target data available for this crispr