ID: 1030766243

View in Genome Browser
Species Human (GRCh38)
Location 7:113413337-113413359
Sequence GGTCTGAATAGAACAAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030766243_1030766246 -9 Left 1030766243 7:113413337-113413359 CCACCTTTTGTTCTATTCAGACC No data
Right 1030766246 7:113413351-113413373 ATTCAGACCCTCAAAGGATTCGG No data
1030766243_1030766249 11 Left 1030766243 7:113413337-113413359 CCACCTTTTGTTCTATTCAGACC No data
Right 1030766249 7:113413371-113413393 CGGTGATGCTCACCACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030766243 Original CRISPR GGTCTGAATAGAACAAAAGG TGG (reversed) Intergenic
No off target data available for this crispr