ID: 1030766261

View in Genome Browser
Species Human (GRCh38)
Location 7:113413472-113413494
Sequence CAGAATACCCAGATTAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030766261_1030766263 -7 Left 1030766261 7:113413472-113413494 CCATGTTTAATCTGGGTATTCTG No data
Right 1030766263 7:113413488-113413510 TATTCTGTGGTCCAGTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030766261 Original CRISPR CAGAATACCCAGATTAAACA TGG (reversed) Intergenic
No off target data available for this crispr