ID: 1030766280

View in Genome Browser
Species Human (GRCh38)
Location 7:113413689-113413711
Sequence ATCTACTTTTTTAGGTAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030766280_1030766282 6 Left 1030766280 7:113413689-113413711 CCATATTACCTAAAAAAGTAGAT No data
Right 1030766282 7:113413718-113413740 ATACATTTCCTTTCTCCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030766280 Original CRISPR ATCTACTTTTTTAGGTAATA TGG (reversed) Intergenic
No off target data available for this crispr