ID: 1030771430

View in Genome Browser
Species Human (GRCh38)
Location 7:113480012-113480034
Sequence CTGTACACACAGAAAAAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030771427_1030771430 20 Left 1030771427 7:113479969-113479991 CCAGGAGTTTGAGACTAGCCTGA 0: 122
1: 3469
2: 27070
3: 47685
4: 62006
Right 1030771430 7:113480012-113480034 CTGTACACACAGAAAAAGTTAGG No data
1030771428_1030771430 2 Left 1030771428 7:113479987-113480009 CCTGAGCAACATAGCAAAATCCT No data
Right 1030771430 7:113480012-113480034 CTGTACACACAGAAAAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030771430 Original CRISPR CTGTACACACAGAAAAAGTT AGG Intergenic
No off target data available for this crispr