ID: 1030772182

View in Genome Browser
Species Human (GRCh38)
Location 7:113488196-113488218
Sequence CGGGGAGGCTCAGGCTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030772164_1030772182 28 Left 1030772164 7:113488145-113488167 CCTTGGGCGGTTGATGGGACTGG 0: 22
1: 219
2: 923
3: 574
4: 348
Right 1030772182 7:113488196-113488218 CGGGGAGGCTCAGGCTGTGTGGG No data
1030772173_1030772182 2 Left 1030772173 7:113488171-113488193 CCTTGGAGCAGGGGGTGGCACCC No data
Right 1030772182 7:113488196-113488218 CGGGGAGGCTCAGGCTGTGTGGG No data
1030772163_1030772182 29 Left 1030772163 7:113488144-113488166 CCCTTGGGCGGTTGATGGGACTG 0: 19
1: 223
2: 973
3: 563
4: 325
Right 1030772182 7:113488196-113488218 CGGGGAGGCTCAGGCTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030772182 Original CRISPR CGGGGAGGCTCAGGCTGTGT GGG Intergenic
No off target data available for this crispr