ID: 1030774625

View in Genome Browser
Species Human (GRCh38)
Location 7:113518618-113518640
Sequence ACAGTTTTAAATGGTTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030774625_1030774628 6 Left 1030774625 7:113518618-113518640 CCTTTAAAACCATTTAAAACTGT No data
Right 1030774628 7:113518647-113518669 AAAAGCATAAAGTTTCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030774625 Original CRISPR ACAGTTTTAAATGGTTTTAA AGG (reversed) Intergenic
No off target data available for this crispr