ID: 1030776765

View in Genome Browser
Species Human (GRCh38)
Location 7:113543307-113543329
Sequence GGACGAGTCAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030776765_1030776768 3 Left 1030776765 7:113543307-113543329 CCTCAATTTGCATTGACTCGTCC No data
Right 1030776768 7:113543333-113543355 AATTTGCATATAATTGAAAGTGG 0: 6
1: 93
2: 205
3: 247
4: 708
1030776765_1030776769 4 Left 1030776765 7:113543307-113543329 CCTCAATTTGCATTGACTCGTCC No data
Right 1030776769 7:113543334-113543356 ATTTGCATATAATTGAAAGTGGG 0: 6
1: 92
2: 218
3: 222
4: 650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030776765 Original CRISPR GGACGAGTCAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr