ID: 1030777381

View in Genome Browser
Species Human (GRCh38)
Location 7:113551380-113551402
Sequence CTTAATACACAGTTAAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030777381_1030777384 25 Left 1030777381 7:113551380-113551402 CCATCATTTAACTGTGTATTAAG No data
Right 1030777384 7:113551428-113551450 GAGAAACAATCCAACAGTGCTGG No data
1030777381_1030777385 26 Left 1030777381 7:113551380-113551402 CCATCATTTAACTGTGTATTAAG No data
Right 1030777385 7:113551429-113551451 AGAAACAATCCAACAGTGCTGGG No data
1030777381_1030777382 -5 Left 1030777381 7:113551380-113551402 CCATCATTTAACTGTGTATTAAG No data
Right 1030777382 7:113551398-113551420 TTAAGAATCTTAATACTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030777381 Original CRISPR CTTAATACACAGTTAAATGA TGG (reversed) Intergenic
No off target data available for this crispr