ID: 1030778760

View in Genome Browser
Species Human (GRCh38)
Location 7:113570964-113570986
Sequence TAATTCATATGGAAATGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030778758_1030778760 20 Left 1030778758 7:113570921-113570943 CCTAGCAAATTTTTTAAAAATAG No data
Right 1030778760 7:113570964-113570986 TAATTCATATGGAAATGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030778760 Original CRISPR TAATTCATATGGAAATGTGA TGG Intergenic
No off target data available for this crispr