ID: 1030783647

View in Genome Browser
Species Human (GRCh38)
Location 7:113632994-113633016
Sequence ACATATTCTCCACAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030783647_1030783650 -3 Left 1030783647 7:113632994-113633016 CCTCCCAACTGTGGAGAATATGT No data
Right 1030783650 7:113633014-113633036 TGTTTGTTTACATTACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030783647 Original CRISPR ACATATTCTCCACAGTTGGG AGG (reversed) Intergenic
No off target data available for this crispr